Journal Pre-proof Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent Girme Aoudumbar Ramesh , Deepu Mathew , K. Joseph John , V. Ravisankar PII: DOI: Reference: S2468-0141(21)00049-2 https://doi.org/10.1016/j.hpj.2021.04.001 HPJ 263 To appear in: Horticultural Plant Journal Please cite this article as: Girme Aoudumbar Ramesh , Deepu Mathew , K. Joseph John , V. Ravisankar , Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent, Horticultural Plant Journal (2021), doi: https://doi.org/10.1016/j.hpj.2021.04.001 This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Copyright © 2021 Chinese Society for Horticultural Science (CSHS) and Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS). Publishing services by Elsevier B.V. on behalf of KeAi Communications Co. Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/) ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent Girme Aoudumbar Ramesha, Deepu Mathewa,c,*, K. Joseph Johnb, and V. Ravisankarc a Centre for Plant Biotechnology and Molecular Biology, Kerala Agricultural University, Thrissur, Kerala State 680 656, India b ICAR-National Bureau of Plant Genetic Resources, Regional Station, Thrissur, Kerala State 680 656, India c Bioinformatics Centre, Kerala Agricultural University, Thrissur, Kerala State–680 656, India Received 17 May 2020; Received in revised form 8 December 2020; Accepted 3 February 2021 Available online 2021 ABSTRACT DNA barcoding is a supplementary tool in plant systematics, extensively used to resolve the species level controversies. This paper details the identification of DNA barcodes for seven species of Momordica, using the chloroplast gene matK. Since the species M. cymbalaria has been confused as a member of the genus Luffa, 26 accessions of Momordica belonging to seven Indian species and two accessions of Luffa acutangula were included in this study. Analysis of matK sequences has yielded distinct barcodes in M. charantia var. charantia, M. subangulata subsp. renigera, M. cochinchinensis, M. balsamina, M. cymbalaria and also in Luffa acutangula. Evolutionary status of each species was reflected as nucleotide polymorphisms in each sequence. The wild species M. dioica and M. sahyadrica have yielded one barcode but failed to get differentiated. Further, this study provides conclusive proof that M. cymbalaria is a member of Momordica genus. The phylogram generated was successful to distinguish the monoecious species of this genus, M. charantia, M. balsamina and M. cymbalaria, from the dioecious species M. dioica, M. sahyadrica, M. subangulata subsp. renigera and M. cochinchinensis. Thus, matK locus, by accumulating the evolutionary sequence variations, is proven efficient to differentiate the Momordica species and to reveal their relatedness. Keywords cucurbit; DNA barcoding; Luffa; phylogeny; systematics 1. Introduction The genus Momordica derived from Latin name Mordeo (mordere = to bite) to mention the jagged seeds, is comprised of 59 species (Schaefer and Renner, 2010b). Species Momordica charantia (bitter gourd) is a vegetable with many culinary uses especially in Asia and Africa. In India, there are seven well identified species of which four are dioecious and three are monoecious (Joseph, 2005). The monoecious taxa are M. charantia L. (2n = 22), M. cymbalaria Fenzl ex Naud (2n = 18) and M. balsamina L. (2n = 22). The dioecious taxa are M. dioica Roxb. ex Willd. (2n = 28), M. sahyadrica Joseph et Antony (2n = 28), M. cochinchinensis (Lour.) Spreng. (2n = 28) and M. subangulata Blume subsp. renigera (G. Don) W.J.J de Wilde (2n = 4x = 56). Though the minimal descriptors have been detailed in this genus (Joseph and Antony, 2011), species allocation in few samples remains challenging. Different taxonomic classification approaches have even resulted in controversies about the number of species and their phylogenetic relationships. Further, botanical names and common names are often used incorrectly or interchangeably, making the situation more complicated (Renner and Pandey, 2013). The confusion over the species identification using morphological descriptors alone is such that M. cymbalaria (Hook. Fenzl ex Naud.), which is expected to be under Momordica has been argued for quite long time as a relative of Luffa (Chakravarty, ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. 1982; Bharathi et al., 2011). Luffa includes four old world tropical species [L. echinata Roxb. (dioecious), L. acutangula (L.) Roxb., L. aegyptiaca Mill. (syn. L. cylindrica (L.) M. J. Roem) and L. graveolens] and three Neotropical species (L. quinquefida, L. operculata and L. astorii). Cultivated species L. acutangula includes L. acutangula var. acutangula, L. acutangula var. forskalii Schwein. ex Harms and L. acutangula var. amara (Roxb.) C. B. Clarke. L. aegyptiaca includes the cultivated var. aegyptiaca and wild var. leiocarpa (Naud.) (Heiser and Schilling, 1988; Filipowicz et al., 2014). Accessions belonging to L. acutangula var. acutangula were used in this study to verify the genus status of M. cymbalaria. DNA barcodes enable the rapid and accurate species identification using short, standardized genic regions as internal species tags. In addition to assigning specimens to known species, DNA barcoding will accelerate the pace of species discovery by allowing taxonomists to rapidly sort specimens and by highlighting divergent taxa that may represent new species (Hebert et al., 2004). Cloroplast loci such as rbcL, matK, psbA-trnH, rpoC1, atpF–atpH spacer and psbK-psbI spacer and genomic loci such as ITS have been popularly used as DNA barcodes in plants worldwide (Hollingsworth et al., 2009). In cucurbits, loci such as atpB, ndhF, rbcL, matK, trnL, and spacers trnL-trnF, trnR-atpA, trnS-trnG, rpl20-rps12, psbA-trnH, Ycf9‐trnG, Ycf6‐PsbM have been used to study the phylogeny (Zhang et al., 2006; Kocyan et al., 2007; Schaefer, 2007; Schaefer et al., 2008a, 2008b, 2008c; Volz and Renner, 2009; Schaefer and Renner, 2010b; Sebastian et al., 2010, 2012; Holstein and Renner, 2011; Telford et al., 2012; Filipowicz et al., 2014; Chomicki and Renner, 2015; Endl et al., 2018). Genomic locus ITS was successful to prove that cucurbits Cucumeropsis manni and Posadaea sphaerocarpa could be treated as one species (Schaefer and Renner, 2010a). Additionally, mitochondrial nad1 b/c intron and matR gene, the nuclear ribosomal 18S, ITS1‐5.8S‐ITS2, and 28S genes (Schaefer and Renner, 2011) and second intron on nuclear LFY gene (Volz and Renner, 2009) were also useful in cucurbit systematics. The chloroplast gene matK has been identified as a leading barcode locus by CBOL Plant Working Group (Hollingsworth et al., 2009) and further it was suggested as a universal barcode locus in land plants (Chase et al., 2007; Pennisi, 2007; Lahaye et al., 2008; Newmaster et al., 2008; Seberg and Petersen, 2009). Subsequently, we have shown that this locus is efficient to differentiate the subspecies within Momordica cochinchinensis (Joseph et al., 2018). However, DNA barcode-based species discrimination is rather rare in cucurbits including Momordica. In Momordica, even though the morphology and random marker-based species relations are studied (Bharathi et al., 2012a), DNA barcodes are yet to be developed to exactly differentiate the species and the candidate locus for this purpose is yet to be defined. This study was undertaken with the objective to identify the characteristic barcodes for seven Indian species for Momordica using the matK chloroplast gene. 2. Materials and methods 2.1. Plant material Twenty six accessions belonging to seven species of Momordica and two accessions of Luffa acutangula (‘Haritam’ and ‘Arka Sumit’) were used in this study. Details on the accessions used are presented in Table 1. The accessions were maintained in field under natural conditions and morphological characteristics such as ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent plant growth habit, leaf colour, petiole colour, leaf margin, leaf shape, leaf size, leaf pubescence, flower colour, immature fruit skin colour, fruit surface characteristics, fruit shape and fruit size, were recorded following the minimal descriptors (Joseph and Antony, 2011). Table 1 Description of Momordica and Luffa accessions studied Wild gathered, n = 11, multipurpose, medicinal tuber, germination epigeal, annual, non-tuberous, muricate-tubercled Wild and cultivated, medicinal, monoecious, n = 11, germination epigeal, annual, non-tuberous, muricate-tubercled, seed sides- rectangular, leaf shape- angular Cultivated, monoecious, n = 9, perennial, anthesis late in morning, fruit surface ribbed and seeds were smooth Muricata 1 Muricata 2 Collection Accession number Collected by number Released variety of Kerala Agricultural University, India JDR 01-10 IC321001 Joseph John K., National Bureau of Plant Genetic Resources (NBPGR), India MCC-12 NA Kerala Agricultural University, India MCC-07 NA Kerala Agricultural University, India MCC-18 NA Kerala Agricultural University SBJ/02-94 IC467682 Joseph John K., SBJ/01-15 IC467645 NBPGR Acc. 1 SBJ/03-135 IC467683 Periyakulam PKLM-1 NA Pointed gourd, wild gathered, dioecious, n =14, anthesis in the evening, flower small, pale yellow, intensely musky scented, male calyx whitish yellow, sepals of male flower narrow acute Under exploited but cultivated vegetable, dioecious, n=14, leaf unlobed or shallowly 3 lobed, margins undulate, male calyx green, broad, tip triangular, fruit with short conical projections, seeds large, smooth on surface Wild fruit and leafy vegetable, dioecious, n = 14, petals without purple blotch, male calyx hypanthium cup shaped, flower large showy, bright yellow, feeble scented, male calyx blackish purple KL 1 KL 2 KL 3 KL 4 Odisha SBJ/01-26 SBJ/01-28 SBJ/01-09 SBJ/02-62 CHSG-1 IC467650 IC467651 IC467670 IC467677 No. Species Description Accessions 1 M. charantia var. charantia Bitter gourd, monoecious, n = 11, germination epigeal, annual, non-tuberous, muricate-tubercled, seed sides-rectangular, leaf shape-angular Preethi Kuruppantara Vadakara V53 JNM7 M. charantia var. muricata 2 M. balsamina 3 M. cymbalaria 4 M. dioica 5 M. cochinchinensis 6 M. sahyadrica Primer combination and product size/bp S13 (950) S6 (920) S13 (950) S4 (1320) S9 (1030) S4 (1320) S10 (950) S1 (1150), S3 (920), S7 (1200) College of S13 (950), S17 (1250) Horticulture, Tamil Nadu Agricultural University, Periyakulam, India Joseph John K., S7 (1200), S9 (1030) S4 (1320), S9 (1030) NBPGR S1 (1150), S9 (1030) S2 (1290) S2 (1290) subsp. JB/11-215 cochinchinensis var. North-East subsp. JAS/08-02 andamanica NA S1 (1150), S6 (920) IC567226 S1 (1150), S6 (920) Wild 1 Wild 2 SBJ/02-130 MS2 IC540802 NA Wild 3 SBJ/02-127 IC540803 subsp. anamalayana JJK/99-585 IC256223 S1 (1150) S1 (1150), S4 (1320), S7 (1200) S1 (1150), S4 (1320), S7 (1200) S6 (920) ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. 7 M. subangulata ssp. renigera 8 Luffa acutangula var. acutangula Teasle gourd, wild and cultivated vegetable, dioecious, n = 28, germination hypogeal, perennial, taproot tuberous, nectar of the male flower closed with prominent scales, fruit echinate, petal with black purple blotch, male calyx-hypanthium saucer shaped, leaf cordate, unlobed, margin dentate Ridge gourd or ribbed gourd, monoecious, fruits strongly ridged and not echinate, petals yellow, seeds rugose, without wings, corolla primrose yellow, opening in the evening renigera 1 renigera 2 renigera 3 renigera 4 renigera 5 Arka Gaurav JS/ 07-61 IC553771 JAS/08-12 IC567236 JAS/08-14 IC567238 JAS/08-18 IC567242 JAS/08-19 IC567243 Released variety from Indian Institute of Horticultural Research, Bangalore S6 (920) S1 (1150), S4 (1320) S1 (1150), S2 (1290) S2 (1290) S2 (1290) S4 (1320), S7 (1200) Haritam Arka Sumit Released variety from Kerala Agricultural University Released variety from Indian Institute of Horticultural Research, Bangalore S13 (950), S17 (1250) S13 (950), S17 (1250) Note: Accessions maintained at National Bureau of Plant Genetic Resources (NBPGR) Regional Station, Thrissur and Kerala Agricultural University, India. 2.2. Molecular analyses Tender leaves, first to third from the tip, were collected on ice, surface wiped with 70% ethanol and used for total genomic DNA isolation (Rogers and Bendich, 1994). The chloroplast gene matK was used as the barcode locus. Since the primer combination for PCR amplification of this locus in Momordica was not available, universal primers for this gene was initially attempted. Sequences of the universal primer (Saslis-Lagoudakis et al., 2008; van de Wiel et al., 2009; Dunning and Savolainen, 2010; Yu et al., 2011) sets and their combinations attempted are presented in Tables 2 and 3. PCR amplification was performed in a 20 µL reaction mixture consisting 1 µL of genomic DNA (30 ng), 2 µL of 10× Taq assay buffer A, 1.5 µL of dNTP mix (10 mmol · L-1 each), 0.3 µL of Taq DNA polymerase (3 U), and 0.75 µL each of primers (10 pmmol · L-1). Table 2 Sequences of universal matK primers used in this study No. 1 Primer matK F1 matK R1 matK F2 matK R2 matK F3 matK R3 matK F4 matK R4 matK F5 matK R5 matK F6 matK R6 2 3 4 5 6 Primer name 21.F 5R Kew matK 2.1F 3.2R 390F 1326R XF MALV_R1 1R_KIM 3F_KIM ASP_F LAM_R Sequence (5’–3’) CCTATCCATCTGGAAATCTTAG GTTCTAGCACAAGAAAGTCG ATCCATCTGGAAATCTTAGTTC CTTCCTCTGTAAAGAATTC CGATCTATTCATTCAATATTTC TCTAGCACACGAAAGTCGAAGT (T)AATTTACGATCAATTCATTC TAATGAGAAAGATTTCTGCATAT ACCCAGTCCATCTGGAAATCTTGGTTC CGTACAGTACTTTTGTGTTTACGAG TCAGAATTTACGATCTATTC GCACAAGAAAGTCGAAGTATATA Reference Yu et al., 2011 Dunning and Savolainen, 2010 van de Wiel et al. 2009 Saslis-Lagoudakis et al., 2008 Dunning and Savolainen, 2010 Table 3 Combinations of forward and reverse primer used for amplifying matK locus in Momordica No. Primer set 1 S1 Annealing temperature/°C 51.7 Annealing Primer combination No. Primer set matK F1 10 S10 48.4 11 S11 49.5 temperature/°C matK R1 2 S2 45.2 matK F2 Primer combination matK F4 matK R4 matK F5 ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent matK R2 3 S3 49.5 matK F3 matK R5 12 S12 55.6 13 S13 48.4 14 S14 48.4 15 S15 49.5 16 S16 49.5 17 S17 57.9 18 S18 51.7 matK R3 4 S4 45.2 matK F1 matK R6 matK R2 5 S5 53.2 matK F1 S6 51.7 matK F2 S7 52.7 matK F2 S8 49.5 matK F3 S9 45.2 matK F3 matK F5 matK R6 matK R1 9 matK F5 matK R4 matK R3 8 matK F4 matK R6 matK R1 7 matK F4 matK R5 matK R3 6 matK F6 matK F6 matK R4 matK R2 matK F6 matK R5 The PCR amplification was carried out with the thermal profile suggested by CBOL (Ivanova et al., 2006) which consisted of initial denaturation at 94 °C for 1 min followed by 40 cycles of denaturation at 94 °C for 30 s, annealing for 40 s and extension at 72 °C for 40 s, followed by final extension at 72 °C for 5 min. PCR products were gel electrophoresed, bands excised and DNA eluted using NucleoSpin® Gel and PCR Clean-up column (Macherey-Nagel, USA) following manufacturer’s protocol. Eluted DNA samples were thermal cycled again using their respective primer combinations, electrophoresed and products with single intact thick band were Sanger sequenced. For the samples showing primer dimer or multiple bands on reamplification, thermal cycling conditions were optimized to obtain single band suited for direct sequencing. The PCR amplification and Sanger sequencing were performed two times, independently, and maximum forward and reverse read lengths were obtained for 26 Momordica and two Luffa accessions. 2.3. Barcode finding and phylogenetic analysis Forward and reverse reads of each sequence were assembled using CAP3 software. Assembled sequences of 28 lines were aligned along with a reference sequence for matK gene from Momordica, using Clustal Omega. The characteristic SNPs for each species were identified and their positions were determined based on the reference sequence. SNPs characteristic for the species were considered as barcodes. Phylogenetic analyses on the sequences were performed using the software PhyML 3.0 with 1 000 bootstrap iterations. Substitution model GTR was used with estimated gamma shape parameter and the branch support algorithm was SH-like aLRT (Guindon et al., 2010). The substitution model was automatically determined by PhyML. The Maximum Likelihood tree with bootstrap values displayed in percentage was viewed in FigTree 1.4.4 (Rambaut, 2018). 3. Results 3.1. PCR amplification and sequencing of matK locus Twenty six accessions of Momordica, representing seven Indian species were initially evaluated using the minimal descriptors. In situ maintained fully grown plants at fruiting stage were used for the evaluation. Morphological features and fruit characteristics of these accessions are presented in Fig. S1 and Table S1, respectively. The general fruit characteristics of the different Momordica species are presented in Fig. 1. ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. Fig. 1 Fruit characteristics 1a: M. charantia var. charantia; 1b: M. charantia var. muricata; 2: M. dioica; 3: M. cochinchinensis; 4: M. sahyadrica; 5: M. balsamina; 6: M. subangulata ssp. renigera; 7: M. cymbalaria. Of the 18 combinations of universal matK primers attempted in Momordica, 10 combinations were successful to generate the markers in varying number of accessions, at 900 bp size. In Luffa, only two combinations were successful. None of the primer combinations were successful to amplify the markers in all the accessions (Table 1). The matK markers from 26 Momordica and two Luffa accessions were eluted, purified, sequenced and submitted to NCBI GenBank (Momordica - KM453229, KP696795, KP696796, KP696797, KP895555, KP895556, KP895557, KP895558, KP895559, KP895560, KP895561, KP895562, KP895563, KP997312, KP997313, KP997314, KP997315, KP997316, KP997317, KT004664, KT004665, KT984124, KT984125, KT984126, MN176105 Luffa - KP696798, KP759529). Barcode data generated are also made available at Barcode of Life Data system (BOLD, http://www.boldsystems.org) with Process Ids MCYMB001-15, MCVAD001-15, MCJNM001-15, LAHAR001-15, LAARS001-15. 3.2. Barcode finding By aligning 28 sequences, contig of 857 bp conserved across all the sequences was identified. Gene matK spanned at 155 424:156 932 bp (1 508 bp) in the Momordica charantia reference plastome (GenBank: MG022622.1). The contig spanned at 471–1 327 bp in matK. All the five Momordica charantia var. charantia accessions (Table 1) have shown 17 characteristic barcodes at 566, 568–570, 574–579, 666, 874, 917, 981, 1 002, 1 122 and 1 224 bp positions in the gene (Table 4). The ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent barcodes were definite, establishing the species identity. Interestingly, none of them was shared with the close subspecies M. charantia var. muricata, showing that evolutionarily, M. charantia var. charantia and M. charantia var. muricata are distinct. Similarly, none of the barcodes in M. charantia var. charantia were shared with M. subangulata subsp. renigera, M. cochinchinensis, M. dioica and M. sahyadrica. The M. charantia var. charantia shared multiple barcodes with M. balsamina (566, 568–570, 574–579, 874, 917, 981 and 1 002 bp) and M. cymbalaria (566, 568–570, 574–579, 874, 981 and 1 002 bp). In all the dioecious species and M. charantia var. muricata, there was a characteristic six nucleotide deletion spanning 574–579 bp which generated conserved barcodes in monoecious species M. charantia var. charantia, M. balsamina, M. cymbalaria and also in Luffa acutangula. Thus, it could be seen that the cultivated/ monoecious species bear and share more barcodes, pointing to a faster evolution under cultivation compared with the wild types. Though M. charantia var. muricata and M. charantia var. charantia belong to the same species, the wild type had no barcodes. M. subangulata subsp. renigera accessions had highly conserved unique barcodes at 750, 846 and 1 246 bp. Among them, barcodes at 846 bp was shared with Odisha accession of M. dioica, and others were characteristic to this species. Accessions of M. cochinchinensis had one barcode at 1 195 bp, which was unique for this species. Other wild species M. dioica and M. sahyadrica shared one barcodes at 585 bp, which was also seen in M. balsamina. Among the M. dioica accessions, Odisha accession was distinct with the absence of the barcode at 585 bp but two nucleotide polymorphisms were seen at 846 and 1 174 bp. Polymorphism at 1 174 bp was shared with M. sahyadrica ssp. anamalayana. The accession M. sahyadrica ssp. anamalayana had five additional polymorphisms compared to M. sahyadrica ssp. sahyadrica at 1 144–1 146, 1 163 and 1 174 bp, showing a clear distinction among the two sub-species. M. balsamina had 22 barcodes of which 13 were shared with M. cymbalaria and 14 with M. charantia var. charantia. With 19 barcodes, M. cymbalaria was also distinct from the rest of the species. Compared to Momordica species, Luffa had 25 barcodes. Even though 14 of them were shared with M. charantia var. charantia, with the locus wide unique barcodes (806, 826, 1 010, 1 035, 1 036, 1 044, 1 123, 1 131 and 1 149 bp), divergence among the genera was evident. ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. 3.3. Phylogenetic analysis The phylogram (Luffa rooted) generated using the matK sequences (Fig. 2) had distinctly separated Luffa and Momordica accessions. All the Momordica charantia var. charantia accessions have been clustered together with high bootstrap values. Momordica cymbalaria was found to fall within Momordica cluster, clearly showing that even with the fruit shape dissimilarity, this species belongs to Momordica genus, only M. cymbalaria formed sub-cluster within Momordica cluster, showing that matK is good enough to establish species delineations in cucurbits. Fig. 2 Maximum likelihood tree of Indian Momordica species derived using the matK gene sequences Numbers indicate the percent (%) bootstrap values. 4. Discussion 4.1. Barcode analysis The genus Momordica includes 59 species (Schaefer and Renner, 2010b) of which about 12 are reported ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent from Southeast Asia and seven from India (Bharathi and Joseph, 2013). Among these seven, M. charantia var. charantia is extensively grown and marketed whereas, cultivation of M. subangulata subsp. renigera, M. balsamina, M. cochinchinensis and M. cymbalaria is restricted to certain pockets in India. For amplification of matK locus through thermal cycling, primer combination reported by Schaefer and Renner (2010a) was initially attempted in this study. Since this combination has failed to amplify the locus in few M. charantia var. charantia and Luffa accessions, universal primer combinations tried. But those combinations were only partially successful among the accessions. The matK locus was thus amplified in all the accessions using different primer combinations, eluted, cleaned, sequenced and analysed. M. cymbalaria is commercially grown minor vegetable at Periyakulam area in Tamil Nadu state of India. The presence of large number of barcodes obviously points to the extensive cultivation for many years. There has been taxonomic uncertainty on this species, if it belongs to Momordica or Luffa. Of the 19 barcodes identified in M. cymbalaria, 13 were shared with Momordica and six were unique. Species M. cymbalaria Fenzl ex Naud. was initially named Luffa tuberosa (Roxburgh, 1814, 1832) and subsequently transferred to the genus Momordica as Momordica cymbalaria (Clarke, 1879). Then it was renamed M. tuberosa (Roxb.) Cogn (Cogniaux, 1881). Still it has been confused to belong to Luffa due to long pedicellate distinct shaped flowers with exert anthers, similar to ridge gourd (Bharathi and Joseph, 2013). Even though the fruit was similar to Luffa amara Wall., stopple, one of the generic characters of Luffa, was absent in this species and fruits had only eight angles (Roxburgh, 1832). Absence of stopple was a major support for the scientists who argued that it should remain with Momordica. But, the absence of true cystoliths of calcium carbonate on the lower surface of the leaf, which is a characteristic feature of Momordica, forced M. cymbalaria again back to Luffa genus (Chakravarty, 1959). Chakravarty (1982) further supported its position in Luffa since Momordica has either muricate or echinate fruits but never angular. However, similarity of M. cymbalaria’s seed coat (Singh and Dathan, 2001) and seed fat (Azeemoddin and Rao, 1967) characteristics with other members of Momordica genus has forced its retention with Momordica. More recent studies on pollination biology and comparative morphology made scientists to place it under Luffa (Joseph and Antony, 2010) and differences of this species from other Indian species was detailed (Bharathi et al., 2011, 2012a). Still it is closer to African species such as M. sessilifolia, M. kirkii, M. humilis, M. boivinii (Schaefer and Renner, 2010b) and M. cabraei (Ali et al., 2010). Recently, based on ITS sequences of nuclear ribosomal DNA (Ali et al., 2010) and genomic phylogeny (Schaefer and Renner, 2010b), the status of this species in Momordica was established. Till today, M. cymbalaria’s position is unclear especially since multiple attempts to cross it with Momordica species available in India are reported to have failed (Pandey et al., 2006; Bharathi et al., 2011). In the phylogram generated from the present study, it is evident that M. cymbalaria falls within the genus Momordica and the Luffa lines have clustered outside the Momordica cluster. 4.2. Phylogenetic analysis The phylogram has clustered monoecious species M. charantia var. charantia and M. balsamina close to each other. Both these species form the sect Momordica. Interestingly, these two species lie close to the third monoecious species M. cymbalaria which forms the sect Raphanocarpus. Thus, matK locus is successful to differentiate the monoecious species of Momordica from dioecious species. Even though the varieties charantia and muricata are accommodated within M. charantia, barcode analysis at matK locus suggests their independent evolution. Their limited crossability (Bharathi et al., 2012b; Asna et al., ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. 2018) also points to the evolutionary distinctiveness. Accessions of M. charantia var. muricata had no barcode, suggesting that from the base sequence in M. charantia var. muricata, other species with sequences having multiple SNPs might have been evolved. Lack of evolutionary variations at this maternally inherited locus shows that this is the least evolved and progenitor species in Momordica genus. The present results provide the molecular level proof for the previous reports that the wild variety M. charantia var. muricata is the progenitor of cultivated M. charantia var. charantia (Degner, 1947; Walters and Decker-Walters, 1988). Similarly, extensive sequence level variations in cultivated species in comparison with the progenitor species are reported in many plants (Olsen, 2004; Hand et al., 2008; Cheung et al., 2009). Abundant single nucleotide polymorphisms at matK locus in extensively cultivated species M. charantia var. charantia shows that commercial cultivation and human selection in any species leads to rapid generation advancements and evolution (Tang et al., 2010). Thus, commercially grown species are more likely to have barcodes in these candidate loci. Similarly, one accession each in M. dioica and M. sahyadrica had SNPs at this locus, supporting the primitive status of these species (Ali et al., 1991). 4.3. Additional information from the barcode pattern Accessions of Asiatic dioecious wild species M. dioica and M. sahyadrica used in this study were diverse, including a distinct one from Odisha state (India) and an accession belonging to the subspecies anamalayana from Anamalai hills (Kerala state, India), respectively. The species M. sahyadrica was identified from M. dioica, mainly based on the time of flower anthesis (Joseph and Antony, 2004). In both these species, no definite barcode was identified, but the variability observed at matK in Odisha and M. sahyadrica ssp. anamalayana points to their distinct status, demanding further investigations. In the phylogram generated, the dioecious species M. cochinchinensis, M. dioica, M. sahyadrica and M. subangulata subsp. renigera belonging to the sect Cochinchinensis have clustered together. M. dioica with M. cochinchinensis and M. dioica with M. subangulata subsp. renigera are reported to be completely cross compatible. M. cochinchinensis with M. subangulata subsp. renigera and M. sahyadrica with M. cochinchinensis are partially cross compatible (Bharathi et al., 2012b). Similarly, M. dioica and M. sahyadrica fall within the same cluster. It is well shown that M. dioica and M. sahyadrica are genetically closer and cross compatible (Bharathi et al., 2012b). These results clearly show that matK is a candidate locus to differentiate the Momordica species and to understand their relations. 5. Conclusions Confusions over species identity have been a concern in Momordica genus. Very often, M. subangulata subsp. renigera is confused as M. dioica (Hossain et al., 1996) or Momordica cochinchinensis (Sanwal et al., 2011) and similarly, M. cymbalaria has been debated to be included in the genus Luffa. DNA barcoding assists plant taxonomy by studying the characteristic variations for each species in the widely recognised genomic loci. The present study using matK chloroplast gene sequences in 26 accessions of Momordica belonging to seven species and 2 accessions of Luffa has established characteristic barcodes for each species except the wild M. dioica and M. sahyadrica. Additionally, the analysis indicated that M. charantia var. muricata is the progenitor for genus Momordica. ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. Acknowledgments Senior author acknowledges Department of Biotechnology (DBT), Govt. of India, for the fellowship and financial assistance for his M. Sc. (Ag.) in Plant Biotechnology research work (Grant No. CPBMB/CoH/DBTHRD/12). Authors also thank Dr. T. Pradeepkumar, Professor of Horticulture, Kerala Agricultural University, India, for manuscript reading and English usage checking. References Ali, A.M., Karuppusamy, S., Fahad, M., Al-Hemaid, 2010. Molecular phylogenetic study of Luffa tuberosa Roxb. (Cucurbitaceae) based on internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA and its systematic implication. Int J Bioinf Res, 2: 42–60. Ali, M., Okubo, H., Fujii, T., Fujieda, K., 1991. Techniques for propagation and breeding of kakrol (Momordica dioica Roxb.). Sci Hortic, 47: 335–343. Asna, A.C., Joseph, J., Kurien, P.S., John, K.J., 2018. Identification of bitter gourd genotypes with field tolerance to viral diseases. J Tropic Agric, 56: 9–16. Azeemoddin, G., Rao, T.S.D.T., 1967. Seed fat of Momordica tuberosa or Luffa tuberosa. Curr Sci, 36: 100. Bharathi L.K., Joseph J.K., 2013. Momordica genus in Asia: an overview, Springer, New Delhi, pp. 147. Bharathi, L.K., Munshi, A.D., Behera, T.K., Vinod, John, K.J., Bhat, K.V., Das, A.B., Sidhu, A.S., 2012b. Production and preliminary characterization of novel inter-specific hybrids derived from Momordica species. Curr Sci, 103: 178–186. Bharathi, L.K., Munshi, A.D., Vinod Shanti, C., Behera, T.K., Das, A.B., Joseph, J.K., Vishalnath, 2011. Cytotaxonomical analysis of Momordica L. (Cucurbitaceae) species of Indian occurrence. J Genet, 90: 21–30. Bharathi, L.K., Parida, S.K., Munshi, A.D., Behera, T.K., Raman, K.V., Mohapatra, T., 2012a. Molecular diversity and phenetic relationship of Momordica spp. of Indian occurrence. Genet Resour Crop Evol, 59: 937–948. Chase, M.W., Cowan, R.S., Hollingsworth, P.M., van den Berg, C., Madriñán, S., Petersen, G., Seberg, O., Jørgsensen, T., Cameron, K.M., Carine, M., Pedersen, N., Hedderson, T.A.J., Conrad, F., Salazar, G.A., Richardson, J.E., Hollingsworth, M.L., Barraclough, T.G., Kelly, L., Wilkinson, M., 2007. A proposal for a standardised protocol to barcode all land plants. Taxon, 56: 295–299. Chakravarty, H.L., 1959. Monograph of Indian Cucurbitaceae. Records of the Botanical Survey of India, 17: 81. Chakravarty, H.L., 1982. Cucurbitaceae. Fascicles of Flora of India 2, Botanical Survey of India, Howrah, pp. 94. Cheung, F., Trick, M., Drou, N., Lim, Y.P., Park, J.Y., Kwon, S.J., Kim, J.A., Scott, R., Pires, J.C., Paterson, A.H., Town, C., 2009. Comparative analysis between homoeologous genome segments of Brassica napus and its progenitor species reveals extensive sequence-level divergence. Plant Cell, 21: 1912–1928. Chomicki, G., Renner, S.S., 2015. Watermelon origin solved with molecular phylogenetics including Linnaean material: another example of museomics. New Phytol, 205: 526–532. Clarke, C.B., 1879. Cucurbitaceae, in: Hooker, J.D. (ed.), Flora of British India, Reeve, London, pp. 604–635. Cogniaux, A., 1881. Cucurbitacees, in: de Candolle, A.L.P.P. (ed.), Monographiae Phanerogamarum, vol. 3, Paris, pp. 325–951, 979–1008. Degner, 1947. Flora Hawaiiensis, Book 5. Privately Published, Honolulu. Dunning, L.T., Savolainen, V., 2010. Broad-scale amplification of matK for DNA barcoding plants, a technical note. Bot J Linn Soc, 164: 1–9. Endl, J., Achigan‐Dako, E.G., Pandey, A.K., Monforte, A.J., Pico, B., Schaefer, H., 2018. Repeated domestication of melon (Cucumis melo) in Africa and Asia and a new close relative from India. Am J Bot, 105: 1662–1671. Filipowicz, N., Schaefer, H., Renner, S.S., 2014. Revisiting Luffa (Cucurbitaceae) 25 years after C. Heiser: species boundaries and application of names tested with plastid and nuclear DNA sequences. Syst Bot, 39: 205–215. Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol, 59: 307–321. Hand, M.L., Ponting, R.C., Drayton, M.C., Lawless, K.A., Cogan, N.O., Brummer, E.C., Sawbridge, T.I., Spangenberg, G.C., Smith, K.F., Forster, J.W., 2008. Identification of homologous, homoeologous and paralogous sequence variants in an outbreeding allopolyploid species based on comparison with progenitor taxa. Mol Genet Genomics, 280: 293–304. ฀฀฀฀฀฀฀฀฀ Chloroplast Gene matK Holds the Barcodes for Identification of Momordica (Cucurbitaceae) Species from Indian Subcontinent Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., Francis, C.M., 2004. Identification of birds through DNA barcodes. PLoS Biol, 2: e312. Heiser, C.B., Schilling, E.E., 1988. Phylogeny and distribution of Luffa (Cucurbitaceae). Biotropica, 20: 185–191. Hollingsworth, P.M., Forrest, L.L., Spouge, J.L., Hajibabaei, M., Ratnasingham, S., van der Bank, M., Chase, M.W., Cowan, R.S., Erickson, D.L., Fazekas, A.J., Graham, S.W., James, K.E., Kim, K.J., Kress, W.J., Schneider, H., van AlphenStahl, J., Barrett, S.C.H., van den Berg, C., Bogarin, D., Burgess, K.S., Cameron, K.M., Carine, M., Chacón, J., Clark, A., Clarkson, J.J., Conrad, F., Devey, D.S., Ford, C.S., Hedderson, T.A.J., Hollingsworth, M.L., Husband, B.C., Kelly, L.J., Kesanakurti, P.R., Kim, J.S., Kim, Y.D., Lahaye, R., Lee, H.L., Long, D.G., Madriñán, S., Maurin, O., Meusnier, I., Newmaster, S.G., Park, C.W., Percy, D.M., Petersen, G., Richardson, J.E., Salazar, G.A., Savolainen, V., Seberg, O., Wilkinson, M.J., Yi, D.K., Little D.P., 2009. A DNA barcode for land plants. Proc Nat Acad Sci USA, 106: 12794–12797. Holstein, N., Renner, S.S., 2011. A dated phylogeny and collection records reveal repeated biome shifts in the African genus Coccinia (Cucurbitaceae). BMC Evol Biol, 11: 28. Hossain, M.A., Islam, M., Ali, M., 1996. Sexual crossing between two genetically female plants and sex genetics of kakrol (Momordica dioica Roxb.). Euphytica, 90: 121–125. Ivanova, N.V., deWaard, J.R., Hajibabaei, M., Hebert, P.D.N., 2006. Protocols for high volume DNA barcode analysis, draft submission to: DNA working group. Consortium for the Barcode of Life, Canada, pp. 24. Joseph, J.K., 2005. Studies on ecogeography and genetic diversity of the genus Momordica L. in India. [Ph. D. Dissertation]. Mahatma Gandhi University, Kottayam. Joseph, J.K., Antony, V.T., 2011. Developing descriptors for dioecious Momordica species for germplasm characterization and evaluation. Indian J Plant Genet Resour, 24: 31–39. Joseph, J.K., Antony, V.T., 2010. A taxonomic revision of the genus Momordica L. (Cucurbitaceae) in India. Indian J Plant Genet Resour, 23: 172–184. Joseph, J.K., Antony, V.T., 2004. Momordica sahyadrica sp. nov. (Cucurbitaceae), an endemic species of Western Ghats of India. Nordic J Bot, 24: 539–542. Joseph, J.K., Roy, Y.C., Krishnaraj, M.V., Nair, R.A., Mathew, D., Latha, M., Bhat, K.V., Bharathi, L.K., 2018. A new subspecies of Momordica cochinchinensis (Cucurbitaceae) from Andaman Islands, India. Genet Resour Crop Evol, 65: 103–112. Kocyan, A., Zhang, L.B., Schaefer, H., Renner, S.S., 2007. A multi-locus chloroplast phylogeny for the Cucurbitaceae and its implications for character evolution and classification. Mol Phylogenet Evol, 44: 553–577. Lahaye, R., van der Bank, M., Bogarin, D., Warner, J., Pupulin, F., Gigot, G., Maurin, O., Duthoit, S., Barraclough, T.G., Savolainen, V., 2008. DNA barcoding the floras of biodiversity hotspots. Proc Nat Acad Sci USA, 105: 2923–2928. Newmaster, S.G., Fazekas, A.J., Steeves, R.A.D., Janovec, J., 2008. Testing candidate plant barcode regions in the Myristicaceae. Mol Ecol Resour, 8: 480–490. Olsen, K.M., 2004. SNPs, SSRs and inferences on cassava’s origin. Plant Mol Biol, 56: 517–526. Pandey, A.K., Varma, S.K., Ali, A.M., 2006. The genus Luffa in India: diversity and conservation, in: Trivedi, P.C. (ed.), Global Biodiversity Status and Conservation, Pointer publisher, Jaipur, India, pp. 264–270. Pennisi, E., 2007. Wanted: a barcode for plants. Science, 318: 190–191. Rambaut, A., 2018. FigTree: tree figure drawing tool version 1.4.4. Available at: http://tree.bio.ed.ac.uk/software/figtree, Accessed 13 February 2021. Renner, S.S., Pandey, A.K., 2013. The Cucurbitaceae of India: accepted names, synonyms, geographic distribution, and information on images and DNA sequences. PhytoKeys, 20: 53–118. Rogers, S.O., Bendich, A.J., 1994. Extraction of total cellular DNA from plants, algae and fungi, in: Gelvin, S.B., Schilperoort, R.A. (eds.), Plant Molecular Biology Manual, Springer, Dordrecht, pp 183–190. Roxburgh, W., 1814. Hortus Bengalensis, 70: 104. Serampore. Roxburgh, W., 1832. Flora Indica or Descriptions of Indian Plants, Today and Tomorrow Publishers (repr. edn.), New Delhi. Sanwal, S.K., Kozak, M., Kumar, S., Singh, B., Deka, B.C., 2011. Yield improvement through female homosexual hybrids and sex genetics of sweet gourd (Momordica cochinchinensis Spreng.). Acta Physiol Plant, 33: 1991–1996. ฀฀฀฀฀฀฀฀฀ Girme Aoudumbar Ramesh et al. Saslis-Lagoudakis, C., Chase, M.W., Robinson, D.N., Russell, S.J. and Klitgaard, B.B., 2008. Phylogenetics of neotropical Platymiscium (Leguminosae: Dalbergieae): systematics, divergence times, and biogeography inferred from nuclear ribosomal and plastid DNA sequence data. Am J Bot, 95: 1270–1286. Schaefer, H., 2007. Cucumis (Cucurbitaceae) must include Cucumella, Dicoelospermum, Mukia, Myrmecosicyos, and Oreosyce: a recircumscription based on nuclear and plastid DNA data. Blumea, 52: 165–177. Schaefer, H., Heibl, C., Renner, S.S., 2008a. Gourds afloat: a dated phylogeny reveals an Asian origin of the gourd family (Cucurbitaceae) and numerous overseas dispersal events. Proc Roy Soc B Biol Sci, 276: 843–851. Schaefer, H., Kocyan, A., Renner, S.S., 2008b. Linnaeosicyos (Cucurbitaceae): a new genus for Trichosanthes amara, the Caribbean sister species of all Sicyeae. Syst Bot, 33: 349–355. Schaefer, H., Telford, I.R., Renner, S.S., 2008c. Austrobryonia (Cucurbitaceae), a new Australian endemic genus, is the closest living relative to the Eurasian and Mediterranean Bryonia and Ecballium. Syst Bot, 33: 125–132. Schaefer, H., Renner, S.S., 2010a. A gift from the New World? The West African crop Cucumeropsis mannii and the American Posadaea sphaerocarpa (Cucurbitaceae) are the same species. Syst Bot, 35: 534–540. Schaefer, H., Renner, S.S., 2010b. A three-genome phylogeny of Momordica (Cucurbitaceae) suggests seven returns from dioecy to monoecy and recent long distance dispersal to Asia. Mol Phylogenet Evol, 54: 553–560. Schaefer, H., Renner, S.S., 2011. Phylogenetic relationships in the order Cucurbitales and a new classification of the gourd family (Cucurbitaceae). Taxon, 60: 122–138. Sebastian, P.M., Schaefer, H., Telford, I.R.H., Renner, S.S., 2010. Cucumber (Cucumis sativus) and melon (C. melo) have numerous wild relatives in Asia and Australia, and the sister species of melon is from Australia. Proc Nat Acad Sci USA, 107: 14269–14273. Sebastian, P., Schaefer, H., Lira, R., Telford, I.R., Renner, S.S., 2012. Radiation following long‐distance dispersal: the contributions of time, opportunity and diaspore morphology in Sicyos (Cucurbitaceae). J Biogeogr, 39: 1427–1438. Seberg, O., Petersen, G., 2009. How many loci does it take to DNA barcode a crocus? PLoS ONE, 4: e4598. Singh, A., Dathan, A.S.R., 2001. Development and structure of seed coat in the Cucurbitaceae and its implications in systematics, in: Chauhan, S.V.S., Chaturvedi, S.N. (eds.), Botanical Essays: Tribute to Professor Bahadur Singh, Printwell Publishers, Jaipur, pp 87–111. Tang, H., Sezen, U., Paterson, A.H., 2010. Domestication and plant genomes. Curr Opin Plant Biol, 13: 160–166. Telford, I.R., Sebastian, P., de Lange, P.J., Bruhl, J.J., Renner, S.S., 2012. Morphological and molecular data reveal three rather than one species of Sicyos (Cucurbitaceae) in Australia, New Zealand and Islands of the South West Pacific. Aust Syst Bot, 25: 188–201. van de Wiel, C.C.M., Van Der Schoot, J., Van Valkenburg, J.L.C.H., Duistermaat, H., Smulders, M.J.M., 2009. DNA barcoding discriminates the noxious invasive plant species, floating pennywort (Hydrocotyle ranunculoides Lf), from noninvasive relatives. Mol Ecol Resour, 9: 1086–1091. Volz, S.M., Renner, S.S., 2009. Phylogeography of the ancient Eurasian medicinal plant genus Bryonia (Cucurbitaceae) inferred from nuclear and chloroplast sequences. Taxon, 58: 550–560. Walters, T.W., Decker-Walters, D.S., 1988. Balsam pear (Momordica charantia, Cucurbitaceae). Econ Bot, 42: 286–288. Yu, J., Xue, J.X., Zhou, S.L., 2011. New universal matK primers for DNA barcoding angiosperms. J Syst Evol, 49: 176–181. Zhang, L.B., Simmons, M.P., Kocyan, A., Renner, S.S., 2006. Phylogeny of the Cucurbitales based on DNA sequences of nine loci from three genomes: implications for morphological and sexual system evolution. Mol Phylogenet Evol, 39: 305–322.