Molecular phylogenetic analysis of Podostemaceae: implications for taxonomy of major groups

Rolf Rutishauser

This study provides a taxonomic treatment of the Podostemaceae family in southern Brazil. Podostemaceae is the largest family of strictly aquatic angiosperms. The center of family richness is the equatorial region of South America. Taxonomic studies are still scarce in Brazil. For southern Brazil there are six genera and 10 species recognized. Dichotomous key and illustrations are presented for species identification.

bs_bs_banner Botanical Journal of the Linnean Society, 2012, 169, 461–492. With 2 figures Molecular phylogenetic analysis of Podostemaceae: implications for taxonomy of major groups SATOSHI KOI1*, YOKO KITA2, YUMIKO HIRAYAMA1, ROLF RUTISHAUSER3, KONRAD A. HUBER3 and MASAHIRO KATO1 Department of Botany, National Museum of Nature and Science, Tsukuba 305-0005, Japan Department of Biological Sciences, University of Tokyo, Hongo, Tokyo 113-0033, Japan 3 Institute for Systematic Botany, University of Zurich, CH-8008 Zurich, Switzerland 2 Received 23 August 2011; revised 15 January 2012; accepted for publication 27 March 2012 The river-weed family Podostemaceae (c. 300 species in c. 54 genera) shows a number of morphological innovations to be adapted to its unusual aquatic habitat, and its unique or rare bauplan features have been reflected in the traditional (i.e. non-molecular) classification recognizing numerous monotypic or oligospecific genera. The infrasubfamilial relationships of many genera remained unclear. The present study used molecular phylogenetic analysis of matK sequences for 657 samples (c. 132 species/c. 43 genera). The family was traditionally divided into three subfamilies (Podostemoideae, Tristichoideae and Weddellinoideae). American Podostemoideae were shown to be polyphyletic and divided into four clades, i.e. Ceratolacis, Diamantina, Podostemum and all other genera. Among the podostemoid clades, Diamantina was the first branching clade and a clade comprising Mourera and the Apinagia subclade was then sister to the remainder of the New World and Old World Podostemoideae with low statistic supports. The Old World Podostemoideae comprised four monophyletic clades, i.e. two African clades, one Madagascan clade and one Asian clade, although the relationships among these clades and American Ceratolacis and Podostemum were poorly resolved. African Podostemoideae were polyphyletic, with Saxicolella pro parte being weakly supported as sister to the remaining Old World Podostemoideae plus Ceratolacis and Podostemum. In contrast to the American and African clades, monophyly of four Asian subclades was well supported. Plants of Tristicha (Tristichoideae) and of Weddellina (Weddellinoideae), which are currently treated as monospecific, had great matK differentiation equivalent to at least interspecific variation. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492. ADDITIONAL KEYWORDS: biogeography – clusioid Malpighiales – matK – molecular evolution. INTRODUCTION Podostemaceae (river-weeds) are an ecologically and morphologically unusual aquatic angiosperm family. The plants live in rapids and waterfalls in the Tropics and the Subtropics. The vegetative plants of most species are composed of shoot with roots firmly adhering to water-worn rock surfaces. The plants grow vegetatively underwater in the rainy season. The plants flower and fruit during the dry season when the water level drops and, finally, they wither and die. *Corresponding author. Current address: Department of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0192, Japan. E-mail: skoi@bs.naist.jp The body plans of Podostemaceae exhibit great diversity. For example, root morphology ranges from subcylindrical to flattened ribbon-like and to crustose (foliose), and shoots are highly diverse with respect to size, proportion of stem and leaf and branching (Rutishauser, 1997). Some species are devoid of roots (Rutishauser & Grubert, 1994, 1999). Podostemaceae comprise c. 280 species classified in 49 genera, of which 26 genera are monospecific, many genera contain < 10 species, and only a few genera consist of ten species or more (Cook & Rutishauser, 2007). Thus, the obvious morphological differences between the taxa were traditionally taken as significant enough for creating many small (especially monotypic) genera instead of accepting few large ones. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 461 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 1 462 S. KOI ET AL. deduced from matK sequences of all available taxa, including some undescribed taxa (in total 657 samples). Based on the phylogenetic tree obtained, we discuss the infrasubfamilial classification of Podostemaceae. Regional (e.g. African and Asian) taxonomic revisions and biogeography will be published in separate papers. MATERIAL AND METHODS PLANT SAMPLES A total of 365 samples (c. 82 species/c. 33 genera) of Podostemaceae, two samples (two species/one genus) of Hypericaceae and one sample of Calophyllaceae were collected from the field (Appendix 1). They were dried in silica gel. Vouchers are deposited in: the Herbarium (TNS), Department of Botany, National Museum of Nature and Science (Tsukuba, Japan); Forest Herbarium (BKF), Department of National Parks, Wildlife and Plant Conservation (Bangkok, Thailand); Herbarium (TI), University of Tokyo (Tokyo, Japan); and Herbarium (TAIF), Taiwan Forestry Research Institute. Duplicates of many vouchers from Africa and America will be deposited in the combined herbaria of the University and ETH Zürich (Z/ZT). DNA EXTRACTION, AMPLIFICATION AND SEQUENCING Extraction of total DNA from dried material was performed with the DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). The plastid matK region was amplified via polymerase chain reaction (PCR) using Ampdirect plus (Shimadzu, Kyoto, Japan) and TaKaRa Ex Taq polymerase (TaKaRa, Tokyo, Japan) under the following conditions: 3 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 55 °C, 90 s at 72 °C; and 7 min at 72 °C. The primers used for the DNA amplification and the cycle sequencing are listed in Appendix 2. The PCR products were treated with ExoSap-IT (GE Healthcare, Cleveland, OH, USA) to remove the extra primers. Sequencing was conducted using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and the ABI 3130xl Genetic Analyser (Applied Biosystems). PHYLOGENETIC ANALYSES Phylogenetic analysis was performed with the sequences obtained in this study (365 samples) and from GenBank (292 samples), in total 657 samples from c. 132 species of c. 43 genera of Podostemaceae and five samples (five species/four genera/three families) of Malpighiales (Appendix 1; Kita & Kato, 2001, 2004a, b; Kato et al., 2003; Davis & Wurdack, 2004; Moline et al., 2007; Koi et al., 2008, 2009; Thiv et al., © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 The phylogenetic position of Podostemaceae among angiosperms was controversial until recently and has been resolved now by several molecular phylogenetic analyses. Studies with large data sets show that Podostemaceae are members of the clusioid Malpighiales (within fabids = eurosids I), with Hypericaceae as their sister family (Savolainen et al., 2000; Soltis et al., 2000, 2011; Gustafsson, Bittrich & Stevens, 2002; Davis et al., 2005; Tokuoka & Tobe, 2006; APG III, 2009; Korotkova et al., 2009; Wurdack & Davis, 2009; Ruhfel et al., 2011). The relationships in Podostemaceae have been analysed for various groups and geographical regions. They are useful to understand the phylogeny, classification, biogeography and morphological evolution of Podostemaceae as a whole (Kita & Kato, 2001, 2004a, b; Kato, Kita & Koi, 2003; Moline et al., 2006, 2007; Koi, Kita & Kato, 2008; Koi et al., 2009; Pfeifer et al., 2009; Thiv et al., 2009; Kelly, Ameka & Chase, 2010; Koi & Kato, 2010a; Ruhfel et al., 2011; Tippery et al., 2011). In the earliest molecular phylogenetic study, with plastid matK sequences of 31 worldwide samples of 29 species assigned to 20 genera except African species, Kita & Kato (2001) suggested that the family is divided into three subfamilies, Podostemoideae, Weddellinoideae and Tristichoideae, as proposed by Engler (1930), the former two being sister to each other. Podostemoideae, which were the largest subfamily in their tree, comprised paraphyletic American clades and a monophyletic Madagascan and a monophyletic Asian clade. Moline et al. (2007) analysed eight species of three African genera and combined their analyses with the data of Kita & Kato (2001), showing the monophyly of the taxa from continental Africa. Tippery et al. (2011) analysed internal transcribed spacer (ITS), rbcL and trnL regions from 38 taxa of 15 genera, with the result that the Neotropical Podostemoideae, except Podostemum, are divided into ten clades. A recent large-scale analysis by Ruhfel et al. (2011), using plastid matK, ndhF and rbcL and mitochondrial matR genes of 49 species of 35 genera, showed the monophyly of the African, Madagascan and Asian Podostemoideae, and the polyphyly of the American Podostemoideae. Most molecular phylogenetic trees suggested that some large genera, for example, American Apinagia Tul. and African Ledermanniella Engl. sensu Cusset (1983, 1984), are polyphyletic. Based on those phylogenetic relationships, studies of taxonomic reclassification are in progress, resulting in the recognition of c. 300 species assigned to c. 54 genera (Table 1; e.g. Kato, 2004, 2006a; Kato & Koi, 2009; Bove & Philbrick, 2010; Koi & Kato, 2010a; Philbrick, Bove & Stevens, 2010; Ruhfel et al., 2011; Tippery et al., 2011). This paper describes phylogenetic relationships of major lineages in the subfamilies of Podostemaceae, America31 Africa and Madagascar20 Asia and Australia5,6 (20 genera/137 spp.) (17 genera/80 spp.) (18 genera/84 spp.) Podostemoideae (47 genera/280 spp.) Apinagia Tul. Autana C.T.Philbrick Castelnavia Tul. & Wedd. Ceratolacis (Tul.) Wedd. Cipoia C.T.Philbrick, Novelo & Irgang Devillea Tul. & Wedd. Diamantina Novelo, C.T.Philbrick & Irgang Jenmaniella Engl. Lophogyne Tul. Macarenia P.Royen Marathrum Humb. & Bonpl. Monostylis Tul. Mourera Aubl. Noveloa C.T.Philbrick Oserya Tul. & Wedd. Podostemum Michx. Rhyncholacis Tul. Wettsteiniola Suess. Weddellinoideae (1 genus/1 sp.) Weddellina Tul. Tristichoideae (6 genera/19 spp.) Tristicha Thouars 511,31 (< 5034) 133 627,34 215 214,16 13,18 (013) 114 Angolaea Wedd. Dicraeanthus Engl. Djinga C.Cusset Endocaulos C.Cusset Inversodicraea Engl. ex R.E.Fr. Ledermanniella Engl. Leiothylax Warm. 71 132 11 1034 11 82,34 234 53,7,34 1018 (1113) 231 (2231) 31,4 Letestuella G.Taylor Macropodiella Engl. Paleodicraeia C.Cusset Saxicolella Engl.* Sphaerothylax Bis. ex Krauss Stonesia G.Taylor Thelethylax C.Cusset Winklerella Engl. Zehnderia C.Cusset Tristicha Thouars 120 220 120 120 2020,28 2620,28 320 Cladopus H.Möller Farmeria Willis Griffithella (Tul.) Warm. Hanseniella C.Cusset Hydrobryopsis Engl. Hydrobryum Endl. Hydrodiscus Koi & M.Kato 910,17,21,23 16 (28) 16 212 16 (019) 2312,21,24,35 130,35 120 620 120 620 (729) 220 520,26 220 120 120 Maferria C.Cusset Paracladopus M.Kato Polypleurum (Taylor ex Tul.) Warm. Thawatchaia M.Kato, Koi & Y.Kita Willisia Warm. Zeylanidium Engl. 16 (08) 217,22 176,17,24,35 (2011) 117 26,9 56,8 (619) 120 Cussetia M.Kato Dalzellia Wight Indodalzellia Koi & M.Kato Indotristicha P.Royen Terniopsis C.H.Chao 12 12 217 55,17 125 25 810,17,24 463 1 van Royen (1951); 2van Royen (1953); 3van Royen (1954); 4Tur (1975); 5Cusset & Cusset (1988a); 6Cusset (1992); 7Novelo & Philbrick (1995); 8Mathew & Satheesh (1997); 9Shivamurthy & Sadanand (1997); 10Kato & Kita (2003); 11Mathew, Jäger-Zürn & Nileena (2003); 12Kato (2004); 13Philbrick & Novelo (2004); 14Philbrick et al. (2004a); 15Philbrick et al. (2004b); 16Bove et al. (2006); 17Kato (2006a); 18Moline et al. (2006); 19Cook & Rutishauser (2007); 20Rutishauser et al. (2007); 21Kato (2008); 22Koi et al. (2008); 23Kato (2009); 24Kato & Koi (2009); 25Koi et al. (2009); 26Pfeifer et al. (2009); 27Philbrick et al. (2009); 28Thiv et al. (2009); 29Kelly et al. (2010); 30Koi & Kato (2010a); 31Philbrick et al. (2010); 32Bove, Philbrick & Costa (2011); 33Philbrick et al. (2011); 34Tippery et al. (2011); 35Koi & Kato (in press). *The genus Aulea (2 spp.) was proposed by Cusset as a segregate of Saxicolella, although it was not published properly (Lebrun & Stork, 1991). MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Table 1. Current taxonomy of the genera and number of species of Podostemaceae, based on Cook & Rutishauser (2007) and others listed below 464 S. KOI ET AL. RESULTS In the ML tree (Fig. 1), Podostemaceae were divided into two clades, Tristichoideae and a clade consisting of Podostemoideae and Weddellinoideae, and monophyly of each subfamily was supported robustly (100% BP, 1.00 PP). In Tristichoideae, Terniopsis H.C.Chao is sister to Tristicha Thou. plus a clade of Dalzellia Wight, Indodalzellia Koi & M.Kato and Indotristicha P.Royen (Figs 1, 2A–C). Weddellinoideae comprised only Weddellina Tul. (Figs 1, 2D). Podostemoideae were divided into several clades. Diamantina Novelo, C.T.Philbrick & Irgang was sister to the remaining Podostemoideae, the monophyly of which was, however, poorly supported (54% BP, 0.96 PP) (Figs 1, 2E). The second branching clade, supported weakly (76% BP, 1.00 PP), included Mourera Aubl. as sister to Apinagia Tul., Castelnavia Tul. & Wedd., Jenmaniella Engl., Marathrum Humb. & Bonpl. (with Vanroyenella Novelo & C.T.Philbrick merged into Marathrum), Monostylis Tul., Noveloa C.T.Philbrick (syn. Oserya Tul. & Wedd. pro parte), Rhyncholacis Tul. and Wettsteiniola Suess., all of which are distributed in South and Central America (Figs 1, 2F, G). The remaining species comprised six clades: two American, two African, a Madagascan and one Asian. One American clade with poor support (41% BP, 0.67 PP) was composed of Podostemum Michx., including Crenias Spreng. (syn. Mniopsis Mart.), and the other comprised only Ceratolacis pedunculatum C.T.Philbrick, Novelo & Irgang (Figs 1, 2I). Saxicolella agumatsa Ameka & Cheek and S. amicorum J.B.Hall formed one of the African clades (100% BP, 1.00 PP) (Figs 1, 2H). The other African clade (100% BP, 1.00 PP) included Dicraeanthus Engl., Djinga C. Cusset, Inversodicraea Engl. ex R.E.Fr. (syn. Ledermanniella subgenus Phyllosoma C.Cusset), Ledermanniella (syn. Ledermanniella subgenus Ledermanniella), Leiothylax Warm., Letestuella G.Taylor, Macropodiella Engl., Monandriella Engl., Saxicolella nana Engl., Stonesia G.Taylor and Winklerella Engl. (Figs 1, 2J). The Madagascan clade (89% BP, 1.00 PP) was composed of Endocaulos C.Cusset and Thelethylax C.Cusset (Figs 1, 2K). The Asian clade (97% BP, 1.00 PP) was divided into four subclades (Figs 1, 2L–N). The Cladopus subclade (100% BP) was composed of Cladopus H.A.Möller and Paracladopus M.Kato, and the Hydrobryum subclade (100% BP, 1.00 PP) was composed of Hanseniella C.Cusset, Hydrobryum Endl., Hydrodiscus Koi & M.Kato and Thawatchaia M.Kato, Koi & Y.Kita. These two subclades formed a strongly supported monophyletic group (96% BP, 1.00 PP). The Zeylanidium subclade (83% BP, 0.98 PP) consisted of Hydrobryopsis Engl., Willisia Warm. and Zeylanidium Engl. except Z. subulatum (Gardner) C.Cusset, and the Polypleurum subclade (87% BP, 1.00 PP) consisted of Farmeria Willis ex Hook.f., Griffithella (Tul.) Warm., Polypleurum (Tul.) Warm. and Z. subulatum. The sistergroup relationship of the Polypleurum subclade and the Zeylanidium subclade was moderately supported (80% BP, 0.97 PP). DISCUSSION THREE SUBFAMILIES Our phylogenetic tree with the largest sampling data so far is consistent with the previous trees (Kita & Kato, 2001; Moline et al., 2007; Ruhfel et al., 2011) in that the family Podostemaceae consists of three major clades proposed systematically by Engler (1930), i.e. subfamilies Podostemoideae, Weddellinoideae and Tristichoideae, of which the first two are sister to each other. It is in good accordance with the currently accepted three-subfamilial classification (Cook & Rutishauser, 2007). The subfamilies are characterized primarily by floral morphology (Table 2; Jäger-Zürn, 1997b). Tristichoideae and Weddellinoideae share actinomorphic flowers with prominent tepals (fused or free), whereas Podostemoideae are characterized by © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 2009; Kelly et al., 2010; Koi & Kato, 2010a; Ruhfel et al., 2011). The sequences were assembled using SeqMan II (DnaStar, Madison, WI, USA) and aligned by MacClade 4.0 (Maddison & Maddison, 2000). Gaps were treated as missing data. Maximum likelihood (ML) analysis was performed using RAxML 7.2.7 (Stamatakis, Hoover & Rougemont, 2008) from Bital-IT and Cipres cluster web servers (Miller et al., 2009) with a general time reversible (GTR) model + G (shape parameter of the gamma distribution) model (Posada & Crandall, 1998). Bootstrap probability (BP) values were calculated for 1000 replicates. In the Bayesian analysis, the GTR model + I (proportion of invariable sites) + G was selected by the program MrModeltest 2.2 (Nylander, 2004). Nucleotide frequencies were A = 0.3282, C = 0.1399, G = 0.1194, T = 0.4125; the substitution rate matrix was A to C = 1.1407, A to G = 1.1470, A to T = 0.1821, C to G = 0.7971, C to T = 0.9452, G to T = 1.0000; the proportion of invariable sites was 0.1166; and the gamma distribution shape parameter was 1.2290. Markov chain Monte Carlo (MCMC) iterations with four chains were conducted for 5 000 000 generations, sampling a tree every 100 generations, with the program MrBayes 3.1.2 (Ronquist & Huelsenbeck, 2003). The first 12 500 trees were discarded as burn-in and the remaining 37 500 trees were used to determine the posterior probabilities (PP) for branches. The species other than Podostemaceae were treated as outgroups. Tristicha (A) Dalzellia Indodalzellia (B) Indotristicha 100 1.00 100 1.00 100 1.00 Terniopsis (C) 100 1.00 Weddellina (D) Weddellinoideae Diamantina (E) Mourera (F) 100 76 Noveloa Apinagia 1.00 Castelnavia Rhyncholacis 1.00 72 Jenmaniella Wettsteiniola (G) 0.98 Marathrum 100 Monostylis 1.00 Saxicolella (Aulea) (H) 98 1.00 100 1.00 100 1.00 54 0.96 41 0.67 69 1.00 Podostemum (I) Ceratolacis 54 35 0.54 20 - 57 0.69 100 1.00 42 49 0.55 76 1.00 89 1.00 31 0.62 96 1.00 Inversodicraea Monandriella Saxicolella nana (Saxicolella s.s.) (J) Dicraeanthus Djinga Ledermanniella Leiothylax Letestuella Macropodiella Stonesia Endocaulos (K) Winklerella Thelethylax 100 1.00 Cladopus (L) Paracladopus Hanseniella Hydrobryum (N) Hydrodiscus Thawatchaia 100 1.00 97 1.00 83 0.98 America 100 1.00 Africa/Madagascar Asia/Australia 80 0.97 87 1.00 Podostemoideae 100 1.00 Tristichoideae 100 1.00 100 1.00 Hydrobryopsis Willisia Zeylanidium (M) Farmeria Griffithella Polypleurum Zeylanidium subulatum Outgroups 465 Figure 1. Phylogenetic tree of Podostemaceae deduced from RAxML analysis of matK sequences. Numbers above and below branches indicate bootstrap values and Bayesian posterior probabilities, respectively. Triangles indicate clades composed of multiple species (samples) examined, and the vertical lengths of triangles reflect the number of species (samples) examined. Colours indicate continents on which the species are distributed. (A)–(N) correspond to Figure 2A–N. MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 0.01 466 S. KOI ET AL. Table 2. Flower characters of subfamilies of Podostemaceae [as compiled from Jäger-Zürn (1997b) and Cook & Rutishauser (2007)] Character Tristichoideae Weddellinoideae Podostemoideae Flower (perianth) symmetry Spathella* Tepal Actinomorphic Actinomorphic Actinomorphic or zygomorphic Absent Fused into three-lobed ‘calyx’ Present Spathulate to filiform; two to many Stamen Ovary Three, sometimes one or two Tricarpellate and trilocular Stigma Pollen Three Pantoporate Absent Four to six (usually five) free tepals Five to 25 Bicarpellate and bilocular One Tricolporate One to 44 Bicarpellate; bilocular or unilocular (attributable to loss of septum) Usually two Tricolpate, rarely tetra- or pentacolpate *Sac-like envelope covering flower bud. zygomorphic flowers with reduced tepals and flower buds enclosed by spathellas, i.e. special envelops. In contrast, Weddellinoideae and Podostemoideae share bicarpellate flowers. Vegetative characters also characterize the subfamilies. Tristichoideae and Weddellinoideae share nearly radially symmetrical root apical meristems and root caps, with exceptions of the rootless Dalzellia and the capless Tristicha (Koi et al., 2006), sympodially branching shoots with shoot apical meristems (SAMs) and scale-like leaves (Koi & Kato, 2007; Fujinami & Imaichi, 2009). In Podostemoideae, root apical meristems are bilateral-symmetric with dorsiventral root caps, but some species are capless (e.g. Jenmaniella) (Koi et al., 2006) or have linear elongate root meristems resembling fasciation (e.g. Hydrobryum) (Ota, Imaichi & Kato, 2001). The shoots are devoid of SAMs in a morphological sense in Podostemoideae examined (Hammond, 1936; Imaichi, Hiyama & Kato, 2005; Koi, Imaichi & Kato, 2005). Recent analyses of the gene expression patterns of SHOOT MERISTEMLESS, WUSCHEL and ASYMMETRIC LEAVES 1 homologues during shoot development suggested that a species of Tristichoideae (Terniopsis minor M.Kato) has typical SAMs, like model angiosperm plants, whereas species of Podostemoideae (Cladopus doianus (Koidz.) Koriba and Hydrobryum japonicum Imamura) have markedly specialized meristems of mixed shoot and leaf nature (Katayama, Koi & Kato, 2010). The phylogenetic tree shown here confirms the previous suggestions that those floral and vegetative characters shared by Tristichoideae and Weddellinoideae are probably plesiomorphic. TRISTICHOIDEAE AND WEDDELLINOIDEAE Subfamily Tristichoideae comprise six genera (Kato, 2006a), of which Cussetia M.Kato was not examined in this study. The present result that the subfamily is divided into three clades, Terniopsis, Tristicha and a clade of Dalzellia, Indodalzellia and Indotristicha, is congruent with the trees of Koi et al. (2009) and Ruhfel et al. (2011), who analysed smaller sampling data sets than ours. Terniopsis comprises several morphologically similar species and is apparently similar to Tristicha in the short leafy shoots (called ramuli) borne © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Figure 2. RAxML trees of Podostemaceae showing all samples examined. A, Tristicha clade. B, Dalzellia–Indodalzellia– Indotristicha clade. C, Terniopsis clade. D, Weddellina clade. E, Diamantina clade. F, Mourera clade. G, Large early branching clade of additional American Podostemoideae including Apinagia, Castelnavia, Jenmaniella, Marathrum, Monostylis, Noveloa, Rhyncholacis and Wettsteiniola. H, Saxicolella pro parte (i.e. Ghanaian Aulea) clade. I, Podostemum (including Crenias) clade. J, African clade of Podostemoideae including Dicraeanthus, Djinga, Inversodicraea, Ledermanniella, Leiothylax, Letestuella, Macropodiella, Monandriella, Saxicolella s.s., Stonesia and Winklerella. K, Madagascan clade of Podostemoideae including Endocaulos and Thelethylax. L, Cladopus clade (from Asia and Australia) including Cladopus and Paracladopus. M, Asian Polypleurum and Zeylanidium subclades including Farmeria, Griffithella, Polypleurum and Z. subulatum, and Hydrobryopsis, Willisia and Zeylanidium, respectively. N, Asian Hydrobryum subclade including Hanseniella, Hydrobryum, Hydrodiscus and Thawatchaia. Numbers above and below branches indicate bootstrap values (> 50%) and Bayesian posterior probabilities (> 0.80), respectively. 䉴 70 0.99 93 1.00 73 0.80 100 1.00 B 100 1.00 76 0.99 100 1.00 C Terniopsis sessilis CH03/T. cf. sessilis LK205 Terniopsis cf. sessilis LK209 Terniopsis cf. sessilis LK210 Terniopsis sp. LK230 LKF113 56 Terniopsis sp. LK233 99 1.00 99 Terniopsis ubonensis TKF14 TL1307A 1308 1309 Terniopsis ubonensis TL1307B 0.99 Terniopsis sp. LK216 235 62 Terniopsis sp. LK234 0.99 Terniopsis sp. LK218B1 Terniopsis sp. LK218B2 Terniopsis sp. LK225 226 311 Terniopsis sp. LK112A 112B 112C 133 206 240 Terniopsis sp. TPK25 71 Terniopsis sp. TPK27 0.99 Terniopsis chanthaburiensis TL1402 Terniopsis cf. chanthaburiensis LK229 LKF101 100 Terniopsis cf. chanthaburiensis LK227 1.00 Terniopsis cf. chanthaburiensis LK212 Terniopsis cf. chanthaburiensis LK228 0.89 Terniopsis cf. chanthaburiensis LK231A 231B 68 Terniopsis cf. chanthaburiensis LK218A 1.00 Terniopsis cf. chanthaburiensis LKF117 100 Terniopsis sp. LK131 1.00 Terniopsis sp. TPK03 05 08 09 11 12 97 Terniopsis minor TL309 1608 TKF22 23 25 104 105 108 89 Terniopsis minor TL1609 1.00 1.00 Terniopsis brevis TKF16 101 TL320B 321 70 100 Terniopsis brevis TL414 511 0.99 1.00 Terniopsis cf. brevis LK217 LKF112 67 Terniopsis sp. LKF122 0.99 83 Terniopsis sp. LK224 0.99 Terniopsis malayana ML01 & Terniopsis australis AU301 93 Terniopsis malayana TL411 1.00 Terniopsis malayana TL106 412 514 91 1.00 100 1.00 100 1.00 ‘malayana’ subclade 100 1.00 ‘Lao-Thai’ subclade 74 0.98 100 1.00 ‘chanthaburiensis’ subclade 100 1.00 Indodalzellia gracilis KI115 220 224 Indotristicha ramosissima KI26 Indotristicha ramosissima KI111 Indotristicha ramosissima KI215 97 Indotristicha ramosissima KI210 Indotristicha ramosissima A.K. Pradeep 90062 1.00 70 Dalzellia zeylanica KI102 Dalzellia zeylanica KI107 0.89 Dalzellia zeylanica KI212 91 Dalzellia zeylanica KI201 203 205 209 70 Dalzellia zeylanica A.K. Pradeep 90002 1.00 Dalzellia zeylanica SL04 Dalzellia zeylanica SL101 59 Dalzellia zeylanica KI116 218 221 223 0.93 Dalzellia zeylanica A.K. Pradeep 90005A Dalzellia angustissima TKF19 TL1302 1507/D. cf. angustissima LK120 215 219 239 LKF102 108 114 Dalzellia sp. L10 LK201 LKF12 55 Dalzellia ranongensis TL413 1.00 Dalzellia kailarsenii TL1001-1 88 Dalzellia kailarsenii TL1001-2/D. cf. kailarsenii TKF03 05 TPK23 1.00 60 Dalzellia cf. kailarsenii L17 0.96 Dalzellia sp. LK118 Dalzellia sp. LK130 53 Dalzellia ubonensis TKF15 102 0.99 Dalzellia ubonensis TL322 70 88 Dalzellia sp. LK126 1.00 Dalzellia sp. LK236 1.00 Dalzellia sp. LKF111 123 72 - ‘sessilis’ subclade 100 1.00 African subclade 100 1.00 0.01 Figure 2. See caption on previous page. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Tristicha trifaria MX01 Tristicha trifaria MXA Tristicha trifaria MXB Tristicha trifaria BR29 55 Tristicha trifaria C.T. Philbrick 6090 1.00 Tristicha trifaria BR01 64 Tristicha trifaria BR18 1.00 Tristicha trifaria BR22 100 0.93 Tristicha trifaria BR09 1.00 97 Tristicha trifaria CMR33 Tristicha trifaria GH01 1.00 Tristicha trifaria CMR20 Tristicha trifaria CMR48A 100 Tristicha trifaria CMR60 1.00 Tristicha trifaria CMR108 100 Tristicha trifaria CMR48B 1.00 Tristicha trifaria CMR49 53 Tristicha trifaria CMR104 0.98 74 99 Tristicha trifaria Ameka & al. 02-07-07-01 1.00 1.00 Tristicha trifaria CMR111 57 Tristicha trifaria Ameka & al. 02-07-07-11 0.99 Tristicha trifaria CMR121 Tristicha trifaria CMR31 Tristicha trifaria CMR123 100 Tristicha trifaria CMR127 128 1.00 Tristicha trifaria CMR132 66 Tristicha trifaria CMR40 0.94 99 Tristicha trifaria MD03 Tristicha trifaria MDstr46 1.00 99 Tristicha trifaria TA195 Tristicha trifaria TA225 1.00 Tristicha trifaria CMR28 91 Tristicha trifaria CMR29 Tristicha trifaria CMR37 1.00 82 1.00 Afro-Madagascan subclade A 467 Afro-American subclade MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE 468 S. KOI ET AL. D 100 1.00 100 1.00 100 1.00 E Diamantina lombardii BR101 Weddellina squamulosa GK02 04 GU03 20 Weddellina squamulosa GK05 Weddellina cf. squamulosa BR144 Weddellina squamulosa C.T. Philbrick 5827 F Diamantina lombardii BR114 98 Diamantina lombardii BR8006 1.00 100 1.00 Diamantina lombardii C.T. Philbrick 5783 100 1.00 100 1.00 99 1.00 72 0.98 100 1.00 54 - 77 - 60 - 53 - 53 0.97 H 100 1.00 100 1.00 Mourera cf. aspera BR17 Mourera cf. aspera C.T. Philbrick 6093 Mourera sp. BR19B Mourera fluviatilis GK01 08 09B 12 Mourera fluviatilis GK09A Mourera fluviatilis GU24 Rhyncholacis sp. GK06 BR8001 Monostylis capillacea C.T. Philbrick 6076 BR20 Castelnavia monandra C.T. Philbrick 5982 Rhyncholacis sp. BR28 Rhyncholacis cf. penicillata GHK01/Rhyncholacis sp. GHK04 06 07 GU26 Rhyncholacis cf. penicillata GHK02 Rhyncholacis cf. oligandra GK11 13 15 Rhyncholacis cf. apiculata GK03 99 Rhyncholacis sp. GHK05 GU08 11 1.00 Rhyncholacis sp. GU04 100 Rhyncholacis cf. linearis BR26 Rhyncholacis sp. Amaral s.n. 1.00 BR103 83 Apinagia surumuensis GU18 Apinagia longifolia GK07 90 Apinagia longifolia GK10 78 Apinagia longifolia GU21 0.99 Apinagia longifolia C.T. Philbrick 6023 100 Apinagia sp. BR128 77 96 1.00 Apinagia sp. BR130 1.00 Apinagia sp. BR23 63 Apinagia yguazuensis BR31 63 Apinagia sp. BR10 Apinagia sp. BR120 76 69 Apinagia sp. BR143 0.99 Apinagia cf. riedelii BR116 136 139 91 Apinagia riedelii C.T. Philbrick 5960 61 Apinagia sp. BR122 100 Apinagia sp. BR8002 Apinagia cf. crispa BR8005 1.00 Jenmaniella ceratophylla GU17 Noveloa coulteriana C.T. Philbrick 6270 BR27 Wettsteiniola cf. pinnata BR119 Monostylis capillacea BR21 93 Noveloa coulteriana MX07 99 1.00 Marathrum plumosum MX05 77 1.00 100 Marathrum foeniculaceum MX02 0.99 Marathrum foeniculaceum C.T. Philbrick 5958 1.00 Saxicolella agumatsa Ameka 478 Saxicolella agumatsa Ameka 479 Saxicolella amicorum Ameka & deGraft-Johnson 112 Saxicolella amicorum Ameka & deGraft-Johnson 113 100 1.00 98 0.99 I 70 - 67 1.00 Podostemum distichum BR02 112 Podostemum distichum BR127 Podostemum ceratophyllum Kajita 99072501/Podostemum rutifolium subsp. ricciiforme Novelo3979 Podostemum ceratophyllum CTP4615 96 Podostemum ceratophyllum Ruhfel s.n. 1.00 94 Podostemum ceratophyllum Cusick 30042 1.00 98 Podostemum rutifolium subsp. rutifolium BR30 Podostemum rutifolium subsp. ricciiforme MX08 1.00 99 Podostemum scaturiginum BR117 55 Podostemum scaturiginum C.T. Philbrick & al. 5602 1.00 0.93 71 Podostemum saldanhanum BR04 89 1.00 Podostemum saldanhanum BR14 1.00 Podostemum cf. weddellianum BR03 64 Podostemum cf. weddellianum BR08 0.98 Podostemum weddellianum BR110A Podostemum sp. BR06B 86 0.99 0.01 Figure 2. Continued © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 G 100 1.00 99 1.00 MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE 469 J Inversodicraea bosii CMR47 Inversodicraea bosii GAR-021018-01 Inversodicraea ledermannii Ameka & al. 02-07-07-06 100 Inversodicraea ledermannii CMR45A 46 58 102 110 GAR-021018-02 GHO1414 1.00 Inversodicraea ledermannii CMR45B Inversodicraea cf. kamerunensis CMR59 Inversodicraea cf. kamerunensis GB11 12 13 Inversodicraea cristata GHO1659 99 Inversodicraea cristata GHO1664 1.00 Inversodicraea cristata GHO1666 Inversodicraea cristata CMR27 59 GB02 100 GB06 08 1.00 59 59 GB07 Inversodicraea ntemensis CMR65 0.90 Inversodicraea ntemensis CMR114 97 Inversodicraea annithomae Ameka & al. 02-07-07-10 1.00 Inversodicraea cf. annithomae GAHR23 65 Inversodicraea annithomae Ameka & al. 02-07-07-12 Monandriella subclade Monandriella linearifolia GHO1663 Saxicolella subclade Saxicolella nana CMR129 Ledermanniella pellucida CMR30 34 73 Letestuella tisserantii CMR02 97 86 Letestuella tisserantii CMR133 0.83 1.00 1.00 Letestuella tisserantii GHO1660 Stonesia ghoguei GHO1665 89 Ledermanniella bifurcata CMR51 62 Ledermanniella bifurcata GHO1597 1.00 65 97 Ledermanniella bifurcata CMR62 0.99 Ledermanniella bifurcata CMR56/Ledermanniella cf. schlechteri CMR57 1.00 Macropodiella cf. heteromorpha GB04 74 Macropodiella heteromorpha Ameka & al. 02-07-07-08 1.00 Macropodiella heteromorpha Ameka & al. 02-07-07-09 Macropodiella heteromorpha GAHR24 100 Macropodiella heteromorpha CMR113 1.00 71 Macropodiella heteromorpha CMR66 Macropodiella cf. heteromorpha GB01 03 05 09 1.00 Ledermanniella bifurcata GB10 97 Ledermanniella onanai CMR24 39 94 1.00 93 Ledermanniella keayi CMR10A 1.00 100 1.00 Ledermanniella keayi CMR10B 99 1.00 Ledermanniella sp. CMR12 1.00 99 Ledermanniella sanagaensis CMR134 98 Leiothylax quangensis GHO1667 1.00 1.00 Winklerella dichotoma CMR124 Dicraeanthus africanus GHO1413 Dicraeanthus africanus CMR103 107 97 Dicraeanthus africanus CMR43 100 1.00 Dicraeanthus africanus Ameka & al. 02-07-07-02 1.00 Dicraeanthus africanus CMR53 100 Dicraeanthus africanus CMR130 82 1.00 1.00 Dicraeanthus cf. zehnderi CMR131 Dicraeanthus africanus CMR01 100 Dicraeanthus africanus CMR120/Dicraeanthus cf. zehnderi CMR122 126 89 1.00 Dicraeanthus cf. africanus CMR125 1.00 100 Dicraeanthus zehnderi GHO1651 1.00 Dicraeanthus zehnderi GHO1650 100 Ledermanniella letouzeyi CMR41 85 Ledermanniella letouzeyi GAR-021023-12 1.00 100 Ledermanniella sp. CMR13A 1.00 Ledermanniella sp. CMR23 1.00 93 Ledermanniella bowlingii Ameka 501 100 1.00 Ledermanniella bowlingii Ameka 502 Ledermanniella bowlingii Y. Kita & G.K. Ameka s.n. 1.00 Ledermanniella bowlingii AR021010 Ledermanniella linearifolia GHO1415 Ledermanniella linearifolia CMR44A 99 Ledermanniella linearifolia CMR44B 101 109 116 119 1.00 Ledermanniella linearifolia CMR106 57 98 Ledermanniella linearifolia Ameka & al. 02-07-07-04 1.00 Ledermanniella linearifolia Ameka & al. 02-07-07-13 78 Ledermanniella pusilla CMR112 97 Ledermanniella pusilla Ameka & al. 02-07-07-07 85 1.00 Ledermanniella pusilla GAHR17 1.00 Djinga felicis GAR-021020-08 99 Djinga felicis GAR09 1.00 Djinga felicis CMR14 100 Djinga felicis CMR16 1.00 Djinga sp. CMR35 77 0.94 100 1.00 76 1.00 73 0.98 56 0.94 K 89 1.00 99 1.00 Endocaulos mangorense MD02 Thelethylax minutiflora MD01 Thelethylax minutiflora MD4563 0.01 Figure 2. Continued © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 96 1.00 Ledermanniella–Dyad subclade 95 1.00 Ledermanniella–Monad subclade 57 - Inversodicraea subclade 100 1.00 470 S. KOI ET AL. 93 0.98 L Cladopus austrosinensis CH301 Cladopus austrosinensis CH302 Cladopus fukienensis CH01 JK03 Cladopus doianus CH02 JK02 Anraku Manose Mawatari Yamazaki JP127 Cladopus pierrei LK128 132 134 237 241 100 1.00 Cladopus pierrei LK232 1.00 70 Cladopus pierrei LK221 1.00 78 Cladopus pierrei LK117 121 123 LKF103 109 120 1.00 86 Cladopus pierrei LK214 85 Cladopus pierrei LK222 1.00 1.00 Cladopus pierrei LKF118 Cladopus pierrei LK211 Cladopus javanicus ID02 94 Cladopus nymanii ID03 84 1.00 Cladopus nymanii FL02 S01 67 1.00 100 Cladopus queenslandicus AU01 1.00 1.00 Cladopus queenslandicus H. Akiyama 16803 Cladopus taiensis TL101 102 604 92 100 Cladopus fallax TL701 87 1.00 1.00 Cladopus fallax TKF109 TL1610 1.00 Paracladopus chiangmaiensis LK213 89 Paracladopus chiangmaiensis LKF105 110 116 0.99 Paracladopus chiangmaiensis LKF121 LK220 LK223 91 Paracladopus chiangmaiensis LKF119 Vie2 1.00 65 Paracladopus chiangmaiensis TK201 TL1706 1.00 Paracladopus chiangmaiensis TL808 Paracladopus chanthaburiensis TIK21 34 TKF24 TL1533 99 1.00 64 0.99 94 100 1.00 100 1.00 M 100 1.00 83 0.98 100 1.00 95 0.94 100 1.00 100 1.00 96 1.00 80 0.97 100 1.00 100 1.00 100 1.00 87 1.00 95 1.00 99 1.00 62 0.92 100 1.00 68 1.00 99 1.00 0.01 Willisia selaginoides A.K. Pradeep 90006A 90006B 90006C Willisia arekaliana A.K. Pradeep 93196 98 Zeylanidium olivaceum SL09 Zeylanidium olivaceum SL14 1.00 Zeylanidium maheshwarii KI34 80 Zeylanidium sp. KI202 Zeylanidium lichenoides TK02 04 05 TL1703 1704 100 Zeylanidium lichenoides KI37 Zeylanidium lichenoides KI108 1.00 Zeylanidium sp. KI216 Zeylanidium sp. A.K. Pradeep 90001 KI208 Hydrobryopsis sessilis KI206 97 Hydrobryopsis sessilis KI35 119 1.00 Hydrobryopsis sessilis KI204 207 65 61 Griffithella hookeriana C.T. Philbrick 4683 0.99 0.98 Zeylanidium subulatum SL01 Zeylanidium subulatum KI219 Griffithella hookeriana KI103 Griffithella hookeriana KI114 Griffithella hookeriana KI213 214 Farmeria metzgerioides KI110 Polypleurum munnarense A.K. Pradeep 90004 90007 Polypleurum stylosum KI211 217 Polypleurum stylosum KI222 Polypleurum stylosum A.K. Pradeep 90003 99 Polypleurum stylosum KI109 1.00 Polypleurum schmidtianum LK106 TL1527 99 Polypleurum schmidtianum TKF21 106 50 Polypleurum schmidtianum TIK22 23 TL1508A 1508B 1.00 Polypleurum schmidtianum TL1303 64 Polypleurum elongatum SL12 Polypleurum stylosum KI25 SL05 103 104 0.99 Polypleurum wallichii var. wallichii LK127 63 Polypleurum wallichii var. wallichii LK238 66 Polypleurum wallichii var. wallichii L03 LK09 0.97 65 Polypleurum wallichii var. wallichii TL55 Polypleurum wallichii var. wallichii TL601 0.94 Farmeria metzgerioides SL07 Farmeria metzgerioides SL102 100 Polypleurum longistylosum TL318 Polypleurum longistylosum TL1503 1.00 100 Polypleurum longicaule TL901 Polypleurum longicaule TKF10A 10B 10C 11A 11B 12 13 TL708 709 1.00 100 Polypleurum pluricostatum TPK17 18 19 20 21 1.00 62 Polypleurum pluricostatum LK01 02 04 LKF01 67 0.89 Polypleurum pluricostatum LKF03 100 0.89 Polypleurum wongprasertii TL319 1.00 Polypleurum insulare TL1304 1512 1521 1526 Polypleurum sisaketense TL1502 77 87 Polypleurum phuwuaense TL705 1.00 1.00 Polypleurum erectum TL706 98 96 Polypleurum longifolium TL707 1.00 Polypleurum longifolium TL904 1.00 Polypleurum prachinburiense TL1404 1612 88 Polypleurum prachinburiense TL1534 1601-1 1.00 Polypleurum prachinburiense TIK20 TL1601-2 1602 Polypleurum prachinburiense TL1601-3 1603 1604 Figure 2. Continued © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 100 1.00 MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE N 100 1.00 100 1.00 100 1.00 99 1.00 0.83 85 1.00 71 - 66 0.84 Hydrodiscus koyamae L06 Hydrodiscus koyamae L11 LKF13 Hydrodiscus koyamae LK104 Hydrobryum bifoliatum TL310 93 Hydrobryum kaengsophense TL312 Hydrobryum sp. TPK16 1.00 Hydrobryum sp. TPK22 87 Hydrobryum tardhuangense TL208 Hydrobryum tardhuangense LK113 1.00 Hydrobryum khaoyaiense TIF53 TK09 TKF26 100 Hydrobryum micrantherum var. micrantherum TL62 1505 100 1.00 Hydrobryum micrantherum var. crassum TL57 1.00 99 Hydrobryum micrantherum var. crassum TL58 1.00 Hydrobryum micrantherum var. crassum TL306 100 Hydrobryum phetchabunense TKF01 Hydrobryum phetchabunense TL1102 1.00 100 Hydrobryum sp. LK313 314 315 317 99 1.00 Hydrobryum sp. LK316 1.00 85 Hydrobryum sp. TPK01 97 0.81 99 Hydrobryum loeicum TKF06 07 08 TL209 210 TPK06 10 0.99 Hydrobryum loeicum TL211 1.00 Hydrobryum vientianense TKF02 04 TPK24 99 Hydrobryum vientianense TPK28 1.00 Hydrobryum vientianense TPK29 97 Hydrobryum vientianense TPK26A 94 1.00 Hydrobryum vientianense TPK26B 1.00 Hydrobryum vientianense L01 63 Hydrobryum vientianense L02 LK08 0.94 Hydrobryum vientianense L16 75 Hydrobryum vientianense LK06 07 85 1.00 Hydrobryum koribanum JK05 0.95 Hydrobryum puncticulatum JKYaku 100 Hydrobryum japonicum J. Murata & al. 041232 1.00 100 Hydrobryum japonicum CH101 1.00 Hydrobryum japonicum Vie1 93 Hydrobryum japonicum LK301 1.00 97 Hydrobryum japonicum TKF09 TL1103 1.00 Hydrobryum japonicum TL420 65 Hydrobryum japonicum TL415 0.99 Hydrobryum japonicum TL427 65 Hydrobryum japonicum JK01 etc.* 0.99 Hydrobryum floribundum JKAnraku2 Mae 96 Hydrobryum chiangmaiense TL65 1.00 Hydrobryum chiangmaiense TK07 61 Hydrobryum chiangmaiense TL63 64 421 423 430 431 432 807 1707 1.00 Hydrobryum chiangmaiense TL428 77 Hydrobryum chiangmaiense TL429 100 0.98 Hydrobryum chiangmaiense TL801 1.00 Hydrobryum chiangmaiense TL422 66 Hydrobryum chiangmaiense TL424 425 0.96 99 Hydrobryum griffithii TL205 Hydrobryum griffithii CH102 1.00 Hydrobryum austrolaoticum LKF104 106 100 Hydrobryum austrolaoticum LK116 122 1.00 53 Hydrobryum austrolaoticum LK125 LKF115 0.83 Hydrobryum verrucosum L07 100 100 Hydrobryum verrucosum L12 LKF14 1.00 80 1.00 Hydrobryum verrucosum LK105 1.00 Hydrobryum ramosum LK05 LKF05 97 100 Hydrobryum somranii TL703 1.00 Hydrobryum somranii TL704 1.00 Hydrobryum subcrustaceum L15 100 75 Hydrobryum subcrustaceum LKF02 1.00 0.95 54 Hydrobryum subcrustaceum LKF04 63 Hydrobryum subcrustaceum LK03 0.95 100 Hydrobryum takakioides L14 LKF16 Hydrobryum takakioides LK202 1.00 100 Hydrobryum taeniatum L08 1.00 95 Hydrobryum subcylindricum L13 LKF17 1.00 73 Hydrobryum taeniatum LK107 Hydrobryum subcylindricum L09 0.98 79 89 Hanseniella heterophylla TL311 0.94 100 1.00 Hanseniella heterophylla TL1104 1.00 84 Hanseniella heterophylla TPK13 Hanseniella heterophylla TPK15 100 Thawatchaia trilobata TPK02 07 99 Thawatchaia trilobata TPK04 1.00 99 Thawatchaia trilobata TPK14 1.00 100 Thawatchaia trilobata TL419 804 809 1.00 1.00 Thawatchaia trilobata LK307 309 319 100 Thawatchaia trilobata LK310 1.00 Thawatchaia trilobata LK312 0.01 *Hydrobryum japonicum JK01 LK302 303 304 305 306 308 318 TIF115 TK01 03 08 TL206 426 1004 1006 1201 1203 1204 1701 1702 1705 1708 Figure 2. Continued endogenously along the flank of the root and the trimerous flower subtended by two bracts (Kato et al., 2003; Kato, 2006a; S. Koi & M. Kato, unpubl. data). The diagnostic characters that distinguish Terniopsis and Tristicha are root cap (present vs. absent), number of stamens (two or three vs. one or two), stigma (laciniate and free vs. oblong–elliptic and united) and ramuli associated with the flower (present vs. absent) (Cusset & Cusset, 1988a; Kato et al., 2003). In contrast, Dalzellia, Indodalzellia and © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 94 100 1.00 471 472 S. KOI ET AL. PODOSTEMOIDEAE Our analysis with 493 podostemoid samples produced similar results to those published by Ruhfel et al. (2011), that Diamantina lombardii Novelo, C.T.Philbrick & Irgang is first-branching in the subfamily, although the monophyly of the rest is poorly supported. This species is characterized by minute digitate non-vascularized leaves, absence of doublesheathed leaf, a whorl of two to four (usually three) tepals and one to three (usually two) stamens in the zygomorphic flower, and the open bract-like spathella incompletely covering the subterminal flower bud (Philbrick, Novelo & Irgang, 2004a; Rutishauser et al., 2005). Although a whorl of tepals and stamens is shared by many other American species, the open spathella is not seen in other Podostemoideae and the digitate leaves suggested an affinity to Asian Cladopus (Rutishauser et al., 2005). The present molecular tree indicates that Diamantina is probably sister to all other Podostemoideae. The second branching American clade consists of Apinagia, Castelnavia, Jenmaniella, Marathrum including Vanroyenella, Monostylis, Mourera, Noveloa (syn. Oserya pro parte), Rhyncholacis and Wettsteiniola. The phylogenetic position and the monophyly of this clade are supported with moderate bootstrap value and high posterior probability in this analysis. Such a monophyletic relationship is consistent with that of Ruhfel et al. (2011), who did not analyse Jenmaniella and Wettsteiniola. This clade is characterized by pollen in monads and free stamens (i.e. without andropods) (van Royen, 1951, 1953, 1954; Rutishauser, 1997; Rutishauser & Grubert, 1999, 2000; Rutishauser, Novelo & Philbrick, 1999; Cook & Rutishauser, 2007; Philbrick, Bove & Edson, 2009; Philbrick et al., 2010; S. Koi & M. Kato, unpubl. data). Wettsteiniola, analysed for the first time, is nested within this second American clade, and has two to four stamens in an incomplete whorl and pollen in monads (Cook & Rutishauser, 2007). Tippery et al. (2011) analysed a wider range of Neotropical Podostemoideae and revealed that South American Lonchostephus Tul. (merged into Mourera) with widely flattened filaments and Lophogyne Tul. are nested within this clade, based on combined ITS, rbcL and trnL data. The remaining genera with monad pollen and free stamens such as Devillea Tul. & Wedd., Macarenia P.Royen and Tulasneantha P.Royen [merged into Mourera by Tippery et al. (2011)] (van Royen, 1954; Cook & Rutishauser, 2007) have still to be investigated with molecular phylogenetic analysis. Some genera have many (up to 44) stamens and many (six or more) tepals in complete whorls. Tepals and stamens are white to pink and slightly scented, as an adaptation to insect pollination (Okada & Kato, 2002; Cook & Rutishauser, 2007; Sobral-Leite et al., 2011). Such stamens and tepals occur only in this clade of Podostemoideae. The phylogenetic positions of Monostylis are inconsistent between the specimens used in the Ruhfel et al. (2011) study and the present one, requiring further investigation. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Indotristicha are distinct from each other in the shoot organization (ribbon-like to foliose vs. ribbon-like vs. cylindrical), phyllotaxis (dorsal leaves without obvious pattern and marginal leaf in alternate in the former two vs. spiral or non-spiral scale arrangement in the last) and root (absent in the former vs. present in the last two) (Cusset & Cusset, 1988b; Rutishauser & Huber, 1991; Jäger-Zürn, 1992, 1995, 1997a; Mathew, Nileena & Jäger-Zürn, 2001; Imaichi et al., 2004; Koi et al., 2009; Koi & Kato, 2010b). It is therefore likely that the remarkable differences appeared for an equivalent geological time to the relatively uniform sister genus Tristicha. Our phylogenetic analysis using new samples shows that Tristicha is divided into three distinct subclades, i.e. the Afro-American subclade, the Afro-Madagascan subclade and, as sister to both, a truly African sublclade (Fig. 2A). The present phylogenetic relationship of these subclades strongly supports the hypothesis by Kita & Kato (2004b) that Tristicha occurred in Africa and migrated to America. Our ML analysis also indicates that the molecular variations in matK between the three subclades of Tristicha (0.025–0.068 expected amount of change per site) are nearly equivalent to those between four subclades of Terniopsis (the ‘chanthaburiensis’ subclade, the ‘Lao-Thai’ subclade, the ‘malayana’ subclade and the ‘sessilis’ subclade) (0.023– 0.052) and those between Dalzellia, Indodalzellia and Indotristicha (0.038–0.051) (Fig. 2A–C; Appendix 3). Tristicha is usually treated as monotypic (T. trifaria (Bory ex Willd.) Spreng.), even although many local species have been described (Cusset & Cusset, 1988a, c). It is necessary to clarify whether there are multiple species in Tristicha by morphological observation and barcoding analysis (Kelly et al., 2010). Subfamily Weddellinoideae are composed of only Weddellina, which has been considered monospecific (van Royen, 1953; Cook & Rutishauser, 2007). The present study shows that central Brazilian and Guyanan Weddellina form a monophyletic clade. Although the two are similar in vegetative characters (S. Koi & M. Kato, unpubl. data), the samples differ considerably in the matK sequence (Fig. 2D). No floral material is available for the Brazilian specimen and therefore further morphological and molecular analyses on specimens collected from its wide distribution area are necessary to test whether Weddellina is monospecific with infraspecific taxa (Philbrick et al., 2010) or comprises at least two species. MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE 473 Table 3. Key characters to define clades of Podostemoideae Root branching Flower position within spathella Pollen Present Present Present Present¶ Present Absent Present Present¶ Endogenous Endogenous Endogenous Endogenous Endogenous Endogenous/exogenous Endogenous Exogenous** Erect Erect Erect Erect Erect Erect/inverted Inverted Erect Monad/tetrad? Dyad Dyad Monad Dyad Monad/dyad Dyad Dyad *Apinagia, Castelnavia, Jenmaniella, Marathrum, Monostylis, Mourera, Noveloa, Rhyncholacis, Wettsteiniola. †Inversodicraea, Dicraeanthus, Djinga, Ledermanniella, Leiothylax, Letestuella, Macropodiella, Monandriella, Saxicolella s.s., Stonesia, Winklerella. ‡Endocaulos, Thelethylax. §Cladopus, Farmeria, Griffithella, Hanseniella, Hydrobryum, Hydrodiscus, Paracladopus, Polypleurum, Thawatchaia, Willisia, Zeylanidium. ¶Some species have capless roots. **Farmeria exhibits endogenous branching (Willis, 1902). American Podostemum (including Crenias) and Ceratolacis are isolated from other American genera in our matK tree. Like the tree of Ruhfel et al. (2011), Ceratolacis is placed as the sister, with low support, to African Podostemoideae except Saxicolella agumatsa and S. amicorum [both equalling the informal genus Aulea as segregated and proposed by Cusset in Lebrun & Stork (1991), see below]. Pollen is the character to distinguish Podostemum and Ceratolacis from the other American genera, i.e. they have dyad, not monad pollen (Table 3; Philbrick & Novelo, 2004; Philbrick, Novelo & Irgang, 2004b; Moline et al., 2006; Cook & Rutishauser, 2007; Tippery et al., 2011). Cipoia C.T.Philbrick, Novelo & Irgang, sharing characters such as presence of root cap, endogenous root branching and pollen dyads with Ceratolacis and Podostemum, requires molecular phylogenetic analysis (Philbrick et al., 2004a; Bove, Philbrick & Novelo, 2006; Cook & Rutishauser, 2007). Our results suggest that African Podostemoideae are not monophyletic and are divided into two isolated clades, i.e. a small clade of Saxicolella agumatsa and S. amicorum from Ghana, and a large clade of all other species examined. The latter clade comprises large genera, such as Ledermanniella and Inversodicraea, and small genera Dicraeanthus, Djinga, Leiothylax, Letestuella, Macropodiella, Monandriella, Saxicolella nana, Stonesia and Winklerella. The large African clade is characterized by the capless root (Table 3; Thiv et al., 2009; S. Koi, unpubl. data). Saxicolella nana has also capless roots, which discriminate the Ghanaian Saxicolella spp. (see below). Thiv et al. (2009) examined the phylogenetic relationships of African genera with three plastid markers (matK, trnD–trnT, rpoB–trnC) for 23 samples. Based on sample data more than three times larger than those used by Thiv et al. (2009), our tree suggests that the large African clade is divided into five subclades: the Inversodicraea subclade; the Ledermanniella–Monad subclade comprising Ledermanniella pro parte, Leiothylax, Letestuella, Macropodiella, Stonesia and Winklerella; the Ledermanniella–Dyad subclade comprising Ledemanniella pro parte, Dicraeanthus and Djinga; the Monandriella subclade; and the Saxicolella subclade (Fig. 2J). Our grouping of Ledermanniella–Monad and Ledermanniella–Dyad is congruent with Thiv et al. (2009), but our result differs from them in the position of Inversodicraea bosii (C.Cusset) R.Rutish. & Thiv, Saxicolella nana and Winklerella. Key characters for each subclade are summarized in Table 4. Comparing with the other African subclades, the Saxicolella subclade with Saxicolella nana is unique in having endogenously branching capless roots, a scaleless stem, an erect flower within a spathella and dyad pollen (Tables 3 and 4; Cusset, 1987; Rutishauser et al., 2007; S. Koi, unpubl. data). Our tree shows that Winklerella, which has a strongly flattened capsule with lateral wings, is nested within the Ledermanniella–Monad subclade, and this phylogenetic placement is not in conflict with the definition of the subclade by the key characters shown in Table 4 (Cusset, 1987; Rutishauser et al., 2007). Unlike the result of Thiv et al. (2009), that Inversodicraea bosii is isolated from the others, our result shows that it is © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Diamantina Podostemum Ceratolacis & Cipoia American genera* Aulea (Saxicolella pro parte) African genera† Madagascan genera‡ Asian/Australian genera§ Root cap 474 S. KOI ET AL. Table 4. Key characters to define subclades of African Podostemoideae shown in Figure 2J (Cusset, 1987; Cook & Rutishauser, 2007; Rutishauser et al., 2007; Thiv et al., 2009; R. Rutishauser, unpubl. data; S. Koi, unpubl. data) Inversodicraea† Ledermanniella– Monad‡ Ledermanniella– Dyad‡ Monandriella Saxicolella* Stem scale Pollen Flower position in spathella Root morphology Root branching Present Monad/dyad Inverted Absent Monad Erect/inverted Absent Dyad Erect/inverted Absent Monad Inverted Absent Dyad Erect Ribbon-like Endogenous Ribbon-like/foliose Exogenous Ribbon-like/foliose Exogenous Ribbon-like Endogenous Ribbon-like Endogenous †Inversodicraea Engl. as resurrected and redefined by Thiv et al. (2009) comprising all African podostemoid species showing stem scales. These ‘scaly species’ were added to Ledermanniella subgenus Phyllosoma by Cusset (1983, 1987), but turned out to be a separate subclade as sister to all other Podostemoideae from continental Africa that lack stem scales (Thiv et al., 2009; Ruhfel et al., 2011; cladogram Fig. 2J in the present paper). ‡Ledermanniella s.s. as redefined by Thiv et al. (2009) consists of those Ledermanniella spp. that were added to subgenus Ledermanniella by Cusset (1983, 1987), except L. monandra, which was recognized as the monotypic genus Monandriella (with M. linearifolia) by Engler (1930). *Saxicolella s.s. consists of all non-Ghanaian Saxicolella spp. (e.g. S. nana) that differ from the Ghanaian species (e.g. S. agumatsa, S. amicorum) in having unilocular ovaries (attributable to loss of septum) and roots devoid of caps. The Ghanaian species are taken as members of the informal genus ‘Aulea’ (see Table 3). placed at the base of Inversodicraea clade, but with weak statistical supports. Small genera, such as Angolaea Wedd., Butumia G.Taylor, Sphaerothylax Bisch. ex Krauss and Zehnderia C.Cusset, require phylogenetic and taxonomic analysis. The separation of Ghanaian Saxicolella amicorum and S. submersa from S. nana is consistent with Cusset’s proposal to divide the genus Saxicolella s.l. into two genera: Saxicolella s.s. [i.e. sensu Engler, 1926] with S. flabellata (G.Taylor) C.Cusset, S. laciniata (Engl.) C.Cusset, S. marginalis (G.Taylor) C.Cusset ex Cheek and S. nana, and the new genus Aulea C.Cusset ex Lebrun & Stork with A. amicorum (syn. S. amicorum) and A. submersa (syn. S. submersa) (Lebrun & Stork, 1991). Although the two genera share many characters, such as endogenously branching roots, erect flowers and dyad pollen (Table 3), Saxicolella s.s. has unilocular ovaries, i.e. without a septum, whereas Aulea has bilocular ovaries, i.e. with a septum (Ameka, Pfeifer & Rutishauser, 2002). Furthermore, Saxicolella s.s. has capless roots, whereas Aulea has capped ones (Ameka et al., 2002; S. Koi, unpubl. data). Saxicolella s.s. shares the loss of the ovary septum and the loss of the root cap as synapomorphies with the other podostemoids of continental Africa, whereas Aulea retains an ovary septum and root cap as plesiomorphies (Table 3; Ameka et al., 2002, 2003; Moline et al., 2007; Pfeifer et al., 2009; Thiv et al., 2009). Aulea shares capped, endogenously branching roots and dyad pollen with the Madagascan genera, i.e. Endocaulos and Thelethylax, but differs in the position of flowers in spathellas (Table 3; Grob, Pfeifer & Rutishauser, 2007). In Madagascar, four podostemoid genera occur, of which Endocaulos (one species) and Thelethylax (two species) are endemic, whereas Sphaerothylax (c. two species) and probably Paleodicraeia C.Cusset (one species) are also distributed in Africa (Cusset, 1972; Cook & Rutishauser, 2007; R. Rutishauser, unpubl. data). Because Paleodicraeia and Sphaerothylax were not examined, it remains uncertain whether all Madagascan genera form a monophyletic group. Further analysis promises to resolve the phylogenetic and biogeographic relationships between Madagascan and African Podostemoideae. Our analysis is based on much wider sampling data than previous ones (Kita & Kato, 2001; Ruhfel et al., 2011), with a congruent result that Asian Podostemoideae are monophyletic with high support (Figs 1, 2L–N). We found that the clade is divided into four subclades: the Cladopus subclade, the Hydrobryum subclade, the Polypleurum subclade, and the Zeylanidium subclade. The former two are concentrated in South-East and East Asia, whereas the latter two with small satellite genera are diverse in South and South-East Asia (Kato, 2006b). The species in the mainly Asian clade, like those in the American and African clades, exhibit high diversity in morphology, whereas Asian Podostemoideae are distinguished from the other Podostemoideae only in having capped (except some species), exogenously branched roots (except Farmeria) (Table 3). © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Character MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE 475 Table 5. Characters of genera of Asian Podostemoideae (see also Appendix 4) Shoot position* Cladopus subclade Cladopus Ribbon-like C Paracladopus Ribbon-like P –‡ Foliose –‡ D Foliose Foliose/ribbon-like Hydrobryum subclade Hydrodiscus Hanseniella Thawatchaia Hydrobryum Polypleurum subclade Polypleurum Farmeria Griffithella Zeylanidium subulatum Zeylanidium subclade Zeylanidium Hydrobryopsis Willisia Bract Capsule Capsule valve Digitate/ trilobed Digitate/ trilobed Globose, smooth† Unequal Globose, smooth/ ellipsoidal, ribbed Equal/ unequal Ellipsoidal, ribbed Ellipsoidal, ribbed Equal Equal D D/C Simple Simple/ bilobed Trilobed Simple Ellipsoidal, ribbed Ellipsoidal, ribbed Equal Equal/ unequal Ribbon-like C/P Simple Ellipsoidal§, ribbed Ribbon-like Cup-like/ribbon-like Ribbon-like P P C Simple Simple Simple Globose/ellipsoidal, smooth Globose, smooth Ellipsoidal, ribbed Equal/ unequal Unequal Unequal Unequal Ribbon-like/foliose Ribbon-like Foliose/ribbon-like C/D C D/C Simple Simple Simple/ dentate Ellipsoidal, ribbed Globose, smooth Ellipsoidal, smooth Unequal Unequal Unequal *C (Cladopus-type), only at sinus of root branching; P (Paracladopus-type), on lateral flank along length of root including sinus of root branching; D, dorsal surface in foliose root. †Cladopus queenslandicus has ribbed capsule. ‡Hydrodiscus is devoid of root. §Polypleurum sisaketense has globose to ellipsoidal capsule. Cladopus and Paracladopus of the Cladopus subclade share exogenously branched ribbon-like roots, and digitate or lobed bracts, a unique combination of characters in this subclade of Asian Podostemoideae (Table 5; Cusset, 1992). Paracladopus is discriminated from Cladopus by the shoots borne on the lateral flank of the root between successive root branches, the presence of a holdfast and the ensiform leaf (Kato, 2006a; Koi et al., 2008). It is difficult to define diagnostic characters for the Hydrobryum subclade to discriminate it from the other subclades because of its heterogeneity (Table 5). In the Hydrobryum subclade, Hanseniella and Thawatchaia differ from Hydrobryum by the lobed bracts (Cusset, 1992; Kato, 2004) and Hydrodiscus is unique in the absence of root (Koi & Kato, 2010a). Our study provides the first large-scale phylogenetic relationships of Podostemoideae in India and Sri Lanka, which together represent a species-rich region in Asia. The Polypleurum subclade includes Griffithella, Farmeria and Zeylanidium subulatum, in addition to Polypleurum. Griffithella has been treated as congeneric with Cladopus, which is characterized by having globose, smooth-surfaced capsules (Table 5; Cusset, 1992), but this treatment is not supported by the present tree, like that of Ruhfel et al. (2011). Griffithella differs from Cladopus in having a simple bract and from the other genera in having occasionally a cup-like root attached to rocks by the central holdfast (Willis, 1902; Cusset, 1992; Mathew & Satheesh, 1997). Farmeria metzgerioides has single stamens, fewer seeds (one or two), and markedly unequal, smooth capsules (Willis, 1902; Cusset, 1992; Mathew & Satheesh, 1997) and is closely related to Polypleurum. Zeylanidium subulatum has been traditionally assigned to Podostemum (Willis, 1902; Mathew & Satheesh, 1997), but it should be excluded from the American Podostemum and even from Zeylanidium (Philbrick & Novelo, 2004; Cook & Rutishauser, 2007). Our tree also reveals that the Zeylanidium subclade includes Hydrobryopsis, Willisia and Zeylanidium [and Griffithella examined in Ruhfel et al. (2011)]. Willisia is well defined by the simple or dentate bracts (leaves) in four or six rows on © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Root morphology 476 S. KOI ET AL. (Japan), R. Imaichi (Japan), T. Kajita (Japan), N. Katayama (Japan), R. Lilwah (Guyana), S.-J. Lin (China), J.-K. Liu (China) P. Mathew (India), R. Montana (Brazil), J. Murata (Japan), H. Okada (Japan), A. K. Pradeep (India), T. Santisuk (Thailand), S. Suddee (Thailand), B. D. Sumithrarachchi (Sri Lanka), P. Werukamkul (Thailand), T. Wongprasert (Thailand), S.-G. Wu (China), T.-L. Wu (China) and T. Yamada (Japan) for providing material or their help during our field trips, B. R. Ruhfel (USA) for providing matK sequence data of some species and T. Shinkawa (Japan) for his technical support. This study was supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science. CONCLUSIONS REFERENCES The present phylogenetic analysis confirmed three subfamilies in Podostemaceae, and revealed three clades in subfamily Tristichoideae and several clades in Podostemoideae, providing a basis for a future infrasubfamilial classification of Podostemoideae. American Diamantina is isolated from the rest of Podostemoideae. American and African Podostemoideae are possibly not monophyletic, implying complicated evolutionary and biogeographic histories, in contrast to the monophyletic Asian Podostemoideae. The three American clades, i.e. Ceratolacis, Podostemum and the rest of American Podostemoideae (Apinagia–Mourera clade), and Diamantina, the two African clades, i.e. Aulea (= Ghanaian Saxicolella) and the rest of African genera (Inversodicraea– Ledermanniella clade), the Madagascan clade and the Asian clade may warrant tribal rank in a worldwide classification of Podostemoideae. Among the clades, the Dalzellia–Indodalzellia–Indotristicha clade (Tristichoideae), the Apinagia–Mourera clade (Podostemoideae) and the Inversodicraea–Ledermanniella clade (Podostemoideae) are multigeneric and morphologically diverse, whereas the other clades are monogeneric or bigeneric and much less diverse. The monospecific Tristicha and Weddellina have sequence variation equivalent to that of a multi-specific genus or even a clade of multiple genera. A sharp contrast between DNA variation and morphological diversity is seen in the sisters of the Dalzellia–Indodalzellia– Indotristicha clade and Tristicha. Ameka KG, Clerk GC, Pfeifer E, Rutishauser R. 2003. Developmental morphology of Ledermanniella bowlingii (Podostemaceae) from Ghana. Plant Systematics and Evolution 237: 165–183. Ameka KG, Pfeifer E, Rutishauser R. 2002. Developmental morphology of Saxicolella amicorum and S. submersa (Podostemaceae: Podostemoideae) from Ghana. Botanical Journal of the Linnean Society 139: 255–273. APG III. 2009. An update of the angiosperm phylogeny group classification for the orders and families of flowering plants: APG III. Botanical Journal of the Linnean Society 161: 105–121. Bove CP, Philbrick CT. 2010. Neotropical Podostemaceae. In Neotropical flowering plants (Neotropikey): interactive key and information resources for flowering plants of the Neotropics. Available at: http://www.kew.org/science/ tropamerica/neotropikey/families/Podostemaceae.htm Bove CP, Philbrick CT, Costa WJEM. 2011. Taxonomy, distribution and emended description of the Neotropical genus Lophogyne (Podostemaceae). Brittonia 63: 156–160. Bove CP, Philbrick CT, Novelo RA. 2006. A new species of Cipoia (Podostemaceae) from Minas Gerais, Brazil. Systematic Botany 31: 822–825. Cook CDK, Rutishauser R. 2007. Podostemaceae. In: Kubitzki K, ed. The families and genera of vascular plants. 9. Berlin: Springer, 304–344. Cusset C. 1972 (publ. 1973). Les Podostemaceae de Madagascar. Adansonia, série 2 12: 557–568. Cusset C. 1983. Contribution à l’étude des Podostemaceae: 7. Ledermanniella Engl. sous-genre Phyllosoma C. Cusset. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, 5, section B, Adansonia 4: 361–390. Cusset C. 1984. Contribution à l’étude des Podostemaceae: 8. Ledermanniella Engl. sous-genre Ledermanniella. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, 6, section B, Adansonia 3: 249–278. Cusset C. 1987. Podostemaceae and Tristichaceae. In: Satabié B, Morat P, eds. Flore du Cameroun 30. Yaoundé: Ministère de l’Enseignement Supérieur et de la Recherche Scientifique, 51–99. ACKNOWLEDGEMENTS We thank H. Akiyama (Japan), G. K. Ameka (Ghana), L. Ampornpan (Thailand), B.-H. Cheng (China), S.-W. Chung (Taiwan), D. Darnaedi (Indonesia), Y.-F. Deng (China), R. Fujinami (Japan), J.-P. Ghogue (Cameroon), G. G. Hambali (Indonesia), M. Hasebe © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 the long shoots (Cusset, 1992; Mathew & Satheesh, 1997; Shivamurthy & Sadanand, 1997). Hydrobryopsis is characterized by the simple bract, sessile ovary, smooth-surfaced capsule and unequal capsule valves (Cusset, 1992; Mathew & Satheesh, 1997). The rest of the Zeylanidium subclade has simple bracts on reduced shoots (Cusset, 1992; Mathew & Satheesh, 1997). Cook & Rutishauser (2007) embedded the monotypic genus Hydrobryopsis into Zeylanidium (as Z. sessilis), and the present result probably supports such a taxonomic treatment. Indian and Sri Lankan Podostemoideae require substantial reclassification based on phylogenetic relationships with further sampling. MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE ramosissima and Dalzellia ceylanica (Podostemaceae, Tristichoideae): a review. Aquatic Botany 57: 71–96. Jäger-Zürn I. 1997b. Embryological and floral studies in Weddellina squamulosa Tul. (Podostemaceae, Tristichoideae). Aquatic Botany 57: 151–182. Katayama N, Koi S, Kato M. 2010. Expression of SHOOT MERISTEMLESS, WUSCHEL, and ASYMMETRIC LEAVES1 homologs in the shoots of Podostemaceae: implications for the evolution of novel shoot organogenesis. The Plant Cell 22: 2131–2140. Kato M. 2004. Taxonomic study of Podostemaceae of Thailand 1. Hydrobryum and related genera with crustaceous roots (subfamily Podostemoideae). Acta Phytotaxonomica et Geobotanica 55: 133–165. Kato M. 2006a. Taxonomic studies of Podostemaceae of Thailand. 2. Subfamily Tristichoideae and subfamily Podostemoideae with ribbon-like roots. Acta Phytotaxonomica et Geobotanica 57: 1–54. Kato M. 2006b. Distribution and biogeography of Podostemaceae in Asia. Bulletin of the National Science Museum, Tokyo, Series B 32: 19–27. Kato M. 2008. A taxonomic study of Podostemaceae of Japan. Bulletin of the National Museum of Nature and Science, Series B 34: 63–73. Kato M. 2009. Podostemaceae of Malesia: taxonomy, phylogeny and biogeography. Blumea 54: 198–202. Kato M, Kita Y. 2003. Taxonomic study of Podostemaceae of China. Acta Phytotaxonomica et Geobotanica 54: 87–97. Kato M, Kita Y, Koi S. 2003. Molecular phylogeny, taxonomy and biogeography of Malaccotristicha australis comb. nov. (syn. Tristicha australis) (Podostemaceae). Australian Systematic Botany 16: 177–183. Kato M, Koi S. 2009. Taxonomic studies of Podostemaceae of Thailand. 3. Six new and a rediscovered species. Gardens’ Bulletin Singapore 61: 55–72. Kelly LJ, Ameka GK, Chase MW. 2010. DNA barcoding of African Podostemaceae (river-weeds): a test of proposed barcode regions. Taxon 59: 251–260. Kita Y, Kato M. 2001. Infrafamilial phylogeny of the aquatic angiosperm Podostemaceae inferred from the nucleotide sequence of the matK gene. Plant Biology 3: 156–163. Kita Y, Kato M. 2004a. Molecular phylogeny of Cladopus and Hydrobryum (Podostemaceae, Podostemoideae) with implications for their biogeography in East Asia. Systematic Botany 29: 921–932. Kita Y, Kato M. 2004b. Phylogenetic relationships between disjunctly occurring groups of Tristicha trifaria (Podostemaceae). Journal of Biogeography 31: 1605–1612. Koi S, Fujinami R, Kubo N, Tsukamoto I, Inagawa R, Imaichi R, Kato M. 2006. Comparative anatomy of root meristem and root cap in some species of Podostemaceae and the evolution of root dorsiventrality. American Journal of Botany 93: 682–692. Koi S, Imaichi R, Kato M. 2005. Endogenous leaf initiation in the apical-meristemless shoot of Cladopus queenslandicus (Podostemaceae) and implications for evolution of shoot morphology. International Journal of Plant Sciences 166: 199–206. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Cusset C. 1992. Contribution à l’étude des Podostemaceae: 12. Les genres asiatiques. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, section B, Adansonia 14: 13–54. Cusset C, Cusset G. 1988a. Etude sur les Podostemales. 9. Délimitations taxinomiques dans les Tristichaceae. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, 10, section B, Adansonia 10: 149–177. Cusset G, Cusset C. 1988b. Etude sur les Podostemales. 10. Structures florales et végétatives des Tristichaceae. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, 10, section B, Adansonia 10: 179–218. Cusset G, Cusset C. 1988c. Etudes sur les Podostemopsida. 11. Répartition et évolution des Tristichaceae. Bulletin du Muséum National d’Histoire Naturelle, Paris, 4e série, 10, section B, Adansonia 10: 223–262. Davis CC, Webb CO, Wurdack KJ, Jaramillo CA, Donoghue MJ. 2005. Explosive radiation of Malpighiales supports a mid-Cretaceous origin of modern tropical rain forests. The American Naturalist 165: E36–E65. Davis CC, Wurdack KJ. 2004. Host-to-parasite transfer in flowering plants: phylogenetic evidence from Malpighiales. Science 305: 676–678. Engler A. 1926. Beiträge zur Flora von Afrika LII. Podostemonaceae Africanae IV. Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 60: 451–467. Engler A. 1930. Reihe Podostemales. In: Engler A, Prantl K, eds. Die natürlichen Pflanzenfamilien, 2nd edn, Vol. 18a. Leipzig: Engelmann, 1–68, 483–484. Fujinami R, Imaichi R. 2009. Developmental anatomy of Terniopsis malayana (Podostemaceae, subfamily Tristichoideae), with implications for body plan evolution. Journal of Plant Research 122: 551–558. Grob V, Pfeifer E, Rutishauser R. 2007. Morphology, development and regeneration of Thelethylax minutiflora, a Madagascan river-weed (Podostemaceae). Phyton 47: 205– 229. Gustafsson MHG, Bittrich W, Stevens PF. 2002. Phylogeny of Clusiaceae based on rbcL sequences. International Journal of Plant Sciences 163: 1045–1054. Hammond BL. 1936. Regeneration of Podostemon ceratophyllum. Botanical Gazette 97: 834–845. Imaichi R, Hiyama Y, Kato M. 2005. Leaf development in absence of shoot apical meirstem in Zeylanidium subulatum (Podostemaceae). Annals of Botany 96: 51–58. Imaichi R, Maeda R, Suzuki K, Kato M. 2004. Developmental morphology of foliose shoots and seedlings of Dalzellia zeylanica (Podostemaceae) with special reference to their meristems. Botanical Journal of the Linnean Society 144: 289–302. Jäger-Zürn I. 1992. Morphologie der Podostemaceae II. Indotristicha ramosissima (Wight) van Royen (Tristichoideae). Tropische und Subtropische Pflanzenwelt 80: 1–48. Jäger-Zürn I. 1995. Morphologie der Podostemaceae III. Dalzellia ceylanica (Gard.) Wight (Tristichoideae). Tropische und Subtropische Pflanzenwelt 92: 1–77. Jäger-Zürn I. 1997a. Comparative morphology of the vegetative structures of Tristicha trifaria, Indotristicha 477 478 S. KOI ET AL. Rutishauser R. 2006. Comparative morphology and molecular systematics of Podostemum (including Crenias): American river-weeds (Podostemaceae). Botanische Jahrbücher für Systematik, Pflanzengeschichte und Pflanzengeographie 126: 427–476. Novelo RA, Philbrick CT. 1995. A new species of Oserya (Podostemaceae) from Jalisco, Mexico. Novon 5: 54–56. Nylander JAA. 2004. Mrmodeltest 2.2. Computer program distributed by the author. Uppsala: Evolutionary Biology Centre, Uppsala University. Okada H, Kato M. 2002. Pollination systems inferred from pollen – ovule rations of some species of Podostemaceae. Acta Phytotaxonomica et Geobotanica 53: 51–61. Ota M, Imaichi R, Kato M. 2001. Developmental morphology of the thalloid Hydrobryum japonicum (Podostemaceae). American Journal of Botany 88: 382–390. Pfeifer E, Grob V, Thiv M, Rutishauser R. 2009. Stonesia ghoguei, peculiar morphology of a new Cameroonian species (Podostemaceae, Podostemoideae). Novon 19: 102–116. Philbrick CT, Bove CP, Edson JTC. 2009. Monograph of Castelnavia (Podostemaceae). Systematic Botany 34: 715– 729. Philbrick CT, Bove CP, Stevens HI. 2010. Endemism in neotropical Podostemaceae. Annals of the Missouri Botanical Garden 97: 425–456. Philbrick CT, Malecki J, Tippery NP, Stevens HI. 2011. A new genus of Podostemaceae from Venezuela. Novon 21: 475–480. Philbrick CT, Novelo RA. 2004. Monograph of Podostemum (Podostemaceae). Systematic Botany Monographs 70: 1–106. Philbrick CT, Novelo RA, Irgang BE. 2004a. Two new genera of Podostemaceae from the state of Minas Gerais, Brazil. Systematic Botany 29: 109–117. Philbrick CT, Novelo RA, Irgang BE. 2004b. A new species of Ceratolacis (Podostemaceae) from the state of Minas Gerais, Brazil. Novon 14: 108–113. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinfomatics 14: 817–818. Ronquist F, Huelsenbeck JP. 2003. MrBayes 3.1.2: Bayesian phylogenetic inference under mixed models. Bioinfomatics 19: 1572–1574. van Royen P. 1951. The Podostemaceae of the New World. Part 1. Mededelingen van het Botanisch Museum en Herbarium van de Rijksuniversiteit te Utrecht 107: 1–151. van Royen P. 1953. The Podostemaceae of the New World II. Acta Botanica Neerlandica 2: 1–21. van Royen P. 1954. The Podostemaceae of the New World III. Acta Botanica Neerlandica 3: 215–263. Ruhfel BR, Bittrich V, Bove CP, Gustafsson MHG, Philbrick CT, Rutishauser R, Xi Z, Davis CC. 2011. Phylogeny of the clusioid clade (Malpighiales): evidence from the plastid and mitochondrial genomes. American Journal of Botany 98: 306–325. Rutishauser R. 1997. Structural and developmental diversity in Podostemaceae (river-weeds). Aquatic Botany 57: 29–70. Rutishauser R, Grubert M. 1994. The architecture of © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Koi S, Kato M. 2007. Developmental morphology of shoot in Weddellina squamulosa (Podostemaceae) and implications for shoot evolution in the Podostemaceae. Annals of Botany 99: 1121–1130. Koi S, Kato M. 2010a. Developmental morphology of shoot and seedling and phylogenetic relationship of Diplobryum koyamae (Podostemaceae). American Journal of Botany 97: 373–387. Koi S, Kato M. 2010b. Developmental anatomy of seedling of Indodalzellia gracilis (Podostemaceae). Plant Biology 12: 794–799. Koi S, Kato M. In press. Taxonomic study of Podostemaceae subfamily Podostemoideae of Laos with phylogenetic analyses of Cladopus, Paracladopus and Polypleurum. Kew Bulletin 67. Koi S, Kita Y, Kato M. 2008. Paracladopus chanthaburiensis, a new species of Podostemaceae from Thailand, with notes on its morphology, phylogeny and distribution. Taxon 57: 201–210. Koi S, Rutishauser R, Kita Y, Kato M. 2009. Phylogenetic relationship and morphology of Dalzellia gracilis (Podostemaceae, subfamily Tristichoideae) with proposal of a new genus. International Journal of Plant Sciences 170: 237–246. Korotkova N, Schneider JV, Quandt D, Worberg A, Zizka G, Borsch T. 2009. Phylogeny of the eudicot order Malpighiales: analysis of a recalcitrant clade with sequences of the petD group II intron. Plant Systematics and Evolution 282: 201–228. Lebrun JP, Stork AL. 1991. Enumeration des plantes à fleurs d’Afrique tropicale. 1. Généralités et Annonaceae à Pandaceae. Geneva: Conservatoire et Jardin botaniques de la Ville de Genève. Maddison DR, Maddison WP. 2000. Macclade 4: analysis of phylogeny and character evolution, version 4.08. Sunderland: Sinauer Associates. Mathew CJ, Nileena CB, Jäger-Zürn I. 2001. Dalzellia gracilis: a new species of Podostemaceae (Tristichoideae) from Kerala, India. International Journal of Plant Sciences 162: 899–909. Mathew CJ, Nileena CB, Jäger-Zürn I. 2003. Morphology and ecology of two new species of Polypleurum (Podostemaceae) from Kerala, India. Plant Systematics and Evolution 237: 209–217. Mathew CJ, Satheesh VK. 1997. Taxonomy and distribution of the Podostemaceae in Kerala, India. Aquatic Botany 57: 243–274. Miller MA, Holder MT, Vos R, Midford PE, Liebowitz T, Chan L, Hoover P, Warnow T. 2009. The CIPRES Portals. Available at: http://www.phylo.org/sub_sections/ portal. Moline P, Thiv M, Ameka GK, Ghogue J-P, Pfeifer E, Rutishauser R. 2007. Comparative morphology and molecular systematics of African Podostemaceae– Podostemoideae, with emphasis on Dicraeanthus and Ledermanniella from Cameroon. International Journal of Plant Sciences 168: 159–180. Moline PM, Don L, Philbrick CT, Novelo RA, Pfeifer E, MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE Thiv M, Ghogue J-P, Grob V, Huber K, Pfeifer E, Rutishauser R. 2009. How to get off the mismatch at the generic rank in African Podostemaceae? Plant Systematics and Evolution 283: 57–77. Tippery NP, Philbrick CT, Bove CP, Les DH. 2011. Systematics and phylogeny of Neotropical riverweeds (Podostemaceae: Podostemoideae). Systematic Botany 36: 105–118. Tokuoka T, Tobe H. 2006. Phylogenetic analyses of Malpighiales using plastid and nuclear DNA sequences, with particular reference to the embryology of Euphorbiaceae sens. str. Journal of Plant Research 119: 599–616. Tur NM. 1975. Nueva especie de Podostemaceae para Argentina: Wettsteiniola apipensis. Bulletin of the Botanical Society of Argentina 16: 320–324. Willis JC. 1902. Studies in the morphology and ecology of the Podostemaceae of Ceylon and India. Annals of the Royal Botanic Gardens, Peradeniya 1: 267–465. Wurdack KJ, Davis CC. 2009. Malpighiales phylogenetics: gaining ground on one of the most recalcitrant clades in the angiosperm tree of life. American Journal of Botany 90: 1151–1570. APPENDIX 1 MATERIALS USED IN THIS STUDY Species names are followed by localities, voucher acronyms of herbaria where vouchers are deposited and GenBank accession numbers of matK sequences (in parentheses). The superscript letters (a–m) indicate the sources, which are defined at the end of Appendix 1. TRISTICHOIDEAE (157 SAMPLES/C. 15 SPECIES/5 GENERA) Dalzellia angustissima M. Kato – Saphanhin waterfall, Ban Tha Sen, Trat, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-19 (BKF, TI, TNS, AB698081); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1302 (BKF, TI, TNS, AB698082); TL-1507 (AB450016h). Dalzellia cf. angustissima M. Kato – Tat Yuang waterfall, Champasak, Laos, S. Koi, N. Katayama & T. Wongprasert LK-120 (BKF, TNS, AB698083); Tad Champy waterfall, Champasak, Laos, S. Koi & T. Wongprasert LK-215 (BKF, TNS, AB698084); Houay Pa Lai river, Ban Kaeng Yao, Bajiang, Champasak, Laos, S. Koi & T. Wongprasert LK-219 (BKF, TNS, AB698085); Tad Hiew Khon waterfall, Ban Muen Hua Mueang, Attapeu, Laos, S. Koi & T. Wongprasert LK-239 (BKF, TNS, AB698086); Houay Champy river, Champasak, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-102 (BKF, TNS, AB698087); Tad Pha Suam waterfall, Bajiang National Park, Champasak, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-108 (BKF, TNS, AB698088); Tad Lo waterfalls, Salavan, Laos, S. Koi, R. Fujinami © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Mourera fluviatilis (Podostemaceae): mature structures and leaf development. Botanica Helvetica 104: 179–194. Rutishauser R, Grubert M. 1999. The architecture of Mourera fluviatilis (Podostemaceae): developmental morphology of inflorescences, flowers, and seedlings. American Journal of Botany 86: 907–922. Rutishauser R, Grubert M. 2000. Developmental morphology of Apinagia multibranchiata (Podostemaceae) from the Benezuelan Guyanas. Botanical Journal of the Linnean Society 132: 299–323. Rutishauser R, Huber KA. 1991. The developmental morphology of Indotristicha ramosissima (Podostemaceae, Tristichoideae). Plant Systematics and Evolution 178: 195–223. Rutishauser R, Novelo RA, Philbrick CT. 1999. Developmental morphology of New World Podostemaceae: Marathrum and Vanroyenella. International Journal of Plant Sciences 160: 29–45. Rutishauser R, Pfeifer E, Grob V, Bernhard A. 2007. Podostemaceae of Africa and Madagascar: keys to genera and species, including genera descriptions, illustrations to all species known, synonyms, and literature list. Available at: http://www.systbot.uzh.ch/static/podostemaceae/index. htm Rutishauser R, Pfeifer P, Novelo RA, Philbrick CT. 2005. Diamantina lombardii – an odd Brazilian member of the Podostemaceae. Flora 200: 245–255. Savolainen V, Fay MF, Albach DC, Backlund A, van der Bank M, Cameron KM, Johnson SA, Lledó MD, Pintaud J-C, Powell M, Sheahan MC, Soltis DE, Soltis PS, Weston P, Whitten WM, Wurdack KJ, Chase MW. 2000. Phylogeny of the eudicots: a nearly complete familial analysis based on rbcL gene sequences. Kew Bulletin 55: 257–309. Shivamurthy GR, Sadanand KB. 1997. A new species of Willisia Warm. (Podostemaceae) from the Silent Valley, Kerala, India. Kew Bulletin 52: 243–245. Sobral-Leite M, Siqueira-Filho JA, Erbar C, Machado IC. 2011. Anthecology and reproductive system of Mourera fluviatilis (Podostemaceae): pollination by bees and xenogamy in a predominantly anemophilous and autogamous family? Aquatic Botany 95: 77–87. Soltis DE, Smith SA, Cellinese N, Wurdack KJ, Tank DC, Brockington SF, Refulio-Rodriguez NF, Walker JB, Moore MJ, Carlsward BS, Bell CD, Latvis M, Crawley S, Black C, Diouf D, Xi Z, Rushworth CA, Gitzendanner MA, Sytsma KJ, Qiu Y-L, Hilu KW, Davis CC, Sanderson MJ, Beaman RS, Olmstead RG, Judd WS, Donoghue MJ, Soltis PS. 2011. Angiosperm phylogeny: 17 genes, 640 taxa. American Journal of Botany 98: 704–730. Soltis DE, Soltis PS, Chase MW, Mort ME, Albach DC, Zanis M, Savolainen V, Hahn WH, Hoot SB, Fay MF, Axtell M, Swensen SM, Price LM, Kress WJ, Nixon KC, Farris JS. 2000. Angiosperm phylogeny inferred from 18S rDNA, rbcL, and atpB sequences. Botanical Journal of the Linnean Society 133: 381–461. Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Systematic Biology 57: 758–771. 479 480 S. KOI ET AL. Huay Banglieng, Ban Lak Saosee, Champasak, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-111 (BKF, TNS, AB698110); loc. cit., S. Koi, R. Fujinami & T. Wongprasert LKF-123 (BKF, TNS, AB698111). Indodalzellia gracilis (Mathew, Jäger-Zürn & Nileena) Koi & M. Kato – KI-115 (AB450015h); Punavoorthode Urulanthanni, near Kothamangla, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-220 (CALI, TNS, AB698112); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-224 (CALI, TNS, AB698113). Indotristicha ramosissima (Wight) P. Royen – A. K. Pradeep 90062 (AB450029h); KI-26 (AB038193a); KI-111 (AB450028h); Cheenganni Puzha near Iritti, Kannur, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-210 (CALI, TNS, AB698114); Pooyam Kutty River, near Kothamanglam, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-215 (CALI, TNS, AB698115). Terniopsis australis (C. Cusset & G. Cusset) M. Kato – AU-301 (AB083094b). Terniopsis brevis M. Kato – Kaeng Lamduam waterfall, Yoddome Wildlife Sanctuary, Ubon Ratchathani, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-16 (BKF, TNS, AB698116); loc. cit., S. Koi, R. Fujinami & T. Wongprasert TKF-101 (BKF, TNS, AB698117); loc. cit., M. Kato, Y. Kita & T. Wongprasert TL-320B (BKF, TI, TNS, AB698118); loc. cit., M. Kato, R. Imaichi & T. Wongprasert TL-511 (BKF, TI, TNS, AB698119); TL-321 (AB450031h); TL-414 (AB450032h). Terniopsis cf. brevis M. Kato – Tad Champy, Champasak, Laos, S. Koi & T. Wongprasert LK-217 (BKF, TNS, AB698120); Huay Banglieng, Ban Lak Saosee, Champasak, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-112 (BKF, TNS, AB698121). Terniopsis chanthaburiensis M. Kato & Koi – TL-1402 (AB450035h). Terniopsis cf. chanthaburiensis M. Kato & Koi – Houay Champy, Champasak, Laos, S. Koi & T. Wongprasert LK-212 (BKF, TNS, AB698122); loc. cit., S. Koi, R. Fijinami & T. Wongprasert LKF-101 (BKF, TNS, AB698123); Houay Pa Lai river, Ban Kaeng Yao, Bajiang, Champasak, Laos, S. Koi & T. Wongprasert LK-218A (BKF, TNS, AB698124); Nam Dong, Ban Mai, Salavan, Laos, S. Koi & T. Wongprasert LK-227 (BKF, TNS, AB698125); Nam Thone stream, Ban Chone, Salavan, Laos, S. Koi & T. Wongprasert LK-228 (BKF, TNS, AB698126); Sesad river, Ban Viangxai, Salavan, Laos, S. Koi & T. Wongprasert LK-229 (BKF, TNS, AB698127); Sesad river, Ban Bueng Kham, Salavan, Laos, S. Koi & T. Wongprasert LK-231A (BKF, TNS, AB698128); loc. cit., S. Koi & T. Wongprasert LK-231B (BKF, TNS, AB698129); Huay Taphung, Salavan, Laos, S. Koi, R. Fijinami & T. Wongprasert LKF-117 (BKF, TNS, AB698130). Terniopsis malayana (J. Dransf. & Whitmore) M. Kato – ML-01 (AB038194a); TL-106 (AB048827a); TL-411 (AB450034h); Huay © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 & T. Wongprasert LKF-114 (BKF, TNS, AB698089). Dalzellia kailarsenii M. Kato – TL-1001-1 (AB450017h); TL-1001-2 (AB450018h). Dalzellia cf. kailarsenii M. Kato – L-17 (AB450024h); Namthob station, Phu Luang Wildlife Sanctuary, Loei, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-3 (BKF, TNS, AB698090); loc. cit., S. Koi, R. Fujinami & T. Wongprasert TKF-5 (BKF, TNS, AB698091); loc. cit., L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-23 (BKF, TNS, AB698092). Dalzellia ranongensis M. Kato – TL-413 (AB450019h). Dalzellia ubonensis M. Kato – Kaeng Lamduam waterfall, Yoddome Wildlife Sanctuary, Ubon Ratchathani, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-15 (BKF, TNS, AB698093); loc. cit., S. Koi, R. Fujinami & T. Wongprasert TKF-102 (BKF, TNS, AB698094); TL-322 (AB450027h). Dalzellia zeylanica (Gardner) Wight – A. K. Pradeep 90002 (AB450025h); A. K. Pradeep 90005A (AB450026h); KI-102 (AB450020h); KI-107 (AB450021h); KI-116 (AB450022h); Pooyam Kutty River, near Kothamanglam, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-218 (CALI, TNS, AB698095); Punavoorthodu Urulanthanni, near Kothamanglam, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-221 (CALI, TNS, AB698096); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-223 (CALI, TNS, AB698097); Thippalikayam near Alungalchattam, Palakkad, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-201 (CALI, TNS, AB698098); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-203 (CALI, TNS, AB698099); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-205 (CALI, TNS, AB698100); Valayah River, Palakkad, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-209 (CALI, TNS, AB698101); Cheenganni Puzha near Iritti, Kannur, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-212 (CALI, TNS, AB698102); SL-04 (AB038190a); Mahaweli Ganga, Kandy, Sri Lanka, M. Kato & N. Katayama SL-101 (CALI, TNS, AB698103). Dalzellia sp. – L-10 (AB450023h); Tham Champee waterfall, Champasak, Laos, S. Koi, N. Katayama & T. Wongprasert LK-118 (BKF, TNS, AB698104); Tad Hiew Khon waterfall, Ban Muen Hua Mueang, Attapeu, Laos, S. Koi, N. Katayama & T. Wongprasert LK-126 (BKF, TNS, AB698105); Tad Nam Pa (Tad Jo) waterfall, Ban Xan Sai, Attapeu, Laos, S. Koi, N. Katayama & T. Wongprasert LK-130 (BKF, TNS, AB698106); Tad Xai waterfall, Phuu Khao Khouay National Park, Bolikhamsai, Laos, S. Koi & T. Wongprasert LK-201 (BKF, TNS, AB698107); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert LKF-12 (BKF, TNS, AB698108); Tad Faek waterfall, Sekong, Laos, S. Koi & T. Wongprasert LK-236 (BKF, TNS, AB698109); MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE LK-216 (BKF, TNS, AB698154); Houay Pa Lai river, Ban Kaeng Yao, Bajiang, Champasak, Laos, S. Koi & T. Wongprasert LK-218B1 (BKF, TNS, AB698155); loc. cit., S. Koi & T. Wongprasert LK-218B2 (BKF, TNS, AB698156); Sedon river, Salavan, Salavan, Laos, S. Koi & T. Wongprasert LK-225 (BKF, TNS, AB698157); Sedon river, Ban Phonebok, Salavan, Laos, S. Koi & T. Wongprasert LK-226 (BKF, TNS, AB698158); Sesad river, Ban Viangxai, Salavan, Laos, S. Koi & T. Wongprasert LK-230 (BKF, TNS, AB698159); Kaeng Koo rapid, Vapy, Salavan, Laos, S. Koi & T. Wongprasert LK-233 (BKF, TNS, AB698160); loc. cit., S. Koi & T. Wongprasert LK-234 (BKF, TNS, AB698161); Tat Hia waterfall, Sekong, Laos, S. Koi & T. Wongprasert LK-235 (BKF, TNS, AB698162); Nam Tha river, Ban Soptout, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-311 (BKF, TNS, AB698163); Tad Lo waterfalls, Salavan, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-113 (BKF, TNS, AB698164); Huay Banglieng, Ban Lak Saosee, Champasak, Laos, S. Koi, R. Fujinami & T. Wongprasert LKF-122 (BKF, TNS, AB698165); Houay Taphuen, Ban Nonsoong, Salavan, Laos, S. Koi & T. Wongprasert LK-224 (BKF, TNS, AB698166); Gang Tham, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-03 (BKF, TNS, AB698167); Gang Ree, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-05 (BKF, TNS, AB698168); Gang Ladkrai, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-08 (BKF, TNS, AB698169); Gang Kongom, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-09 (BKF, TNS, AB698170); Gang Gwang, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-11 (BKF, TNS, AB698171); Gang Tha Laad, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-12 (BKF, TNS, AB698172); Gog-tab waterfall, Phu Luang, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-25 (BKF, TNS, AB698173); Gang Hua Wang Hai, Phu Luang, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-27 (BKF, TNS, AB698174). Tristicha trifaria (Bory ex Willd.) Spreng. – Ameka & al. 02–07-07-01 (FN357254j); Ameka & al. 02–07-07–11 (FN357255j); BR-01 (AB113736d); BR-09 (AB083163b); BR-18 (AB113737d); BR-22 (AB113738d); BR-29 (AB113740d); © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Namsainue, near Haew Lom waterfalls, Phato, Chumphon, Thailand, M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-412 (BKF, TI, TNS, AB698131); Wang Mangmai waterfalls, Khao Luang National Park, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-514 (BKF, TI, TNS, AB698132). Terniopsis minor M. Kato & Koi – Sato stream, Klong Sato, Bo Rai, Trat, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-22 (BKF, TNS, AB698133); loc. cit., S. Koi, R. Fujinami & T. Wongprasert TKF-105 (BKF, TNS, AB698134); TL-1609 (AB450033h); Klong Yai, Pong Nam Ron, Chanthaburi, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-23 (BKF, TNS, AB698135); loc. cit., S. Koi, R. Fujinami & T. Wongprasert TKF-104 (BKF, TNS, AB698136); loc. cit., M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1608 (BKF, TNS, AB698137); Haew Narok waterfalls, Khao Yai National Park, Nakawn Nayok, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-25 (BKF, TNS, AB698138); Klong Kaeo waterfall, Bo Phloi, Bo Rai, Trat, Thailand, S. Koi, R. Fujinami & T. Wongprasert TKF-108 (BKF, TNS, AB698139); TL-309 (AB450030h). Terniopsis sessilis H. C. Chao – CH-03 (AB048377a). Terniopsis cf. sessilis H. C. Chao – Tad Sakhoy rapid, Savannakhet, Laos, S. Koi & T. Wongprasert LK-205 (BKF, TNS, AB698140); Tad Hai waterfall, Ban Hai, Muang Phin, Savannakhet, Laos, S. Koi & T. Wongprasert LK-209 (BKF, TNS, AB698141); Sammataek rapid, Muang Phin, Savannakhet, Laos, S. Koi & T. Wongprasert LK-210 (BKF, TNS, AB698142). Terniopsis ubonensis M. Kato – Kaeng Saphue, Moon River, Ubon Ratchathani, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-14 (BKF, TNS, AB698143); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1307A (BKF, TI, TNS, AB698144); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1307B (BKF, TI, TNS, AB698145); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1309 (BKF, TI, TNS, AB698146); TL-1308 (AB450500h). Terniopsis sp. – Tat Namsanam waterfall, Ban Khounkham, Ban Namsanam Hinboun, Khammouane, Laos, S. Koi, N. Katayama & T. Wongprasert LK-112A (BKF, TNS, AB698147); loc. cit., S. Koi, N. Katayama & T. Wongprasert LK-112B (BKF, TNS, AB698148); loc. cit., S. Koi, N. Katayama & T. Wongprasert LK-112C (BKF, TNS, AB698149); Tad Nam Pa (Tad Jo) waterfall, Ban Xan Sai, Attapeu, Laos, S. Koi, N. Katayama & T. Wongprasert LK-131 (BKF, TNS, AB698150); Sekong river, Kaeng Mueang, Lavy, Attapeu, Laos, S. Koi, N. Katayama & T. Wongprasert LK-133 (BKF, TNS, AB698151); loc. cit., S. Koi & T. Wongprasert LK-240 (BKF, TNS, AB698152); stream on the way to Tad Salaen, Savannakhet, Laos, S. Koi & T. Wongprasert LK-206 (BKF, TNS, AB698153); Tad Champy waterfall, Champasak, Laos, S. Koi & T. Wongprasert 481 482 S. KOI ET AL. PODOSTEMOIDEAE (493 SAMPLES/C. 116 SPECIES/C. 37 GENERA) Apinagia cf. crispa P. Royen – Itapecurú waterfall, Carolina, Maranhao, Brazil, R. Montana & L. F. Pozza BR-8005 (TNS, AB698193). Apinagia longifolia (Tul.) P. Royen – C. T. Philbrick 6023 (HQ331543l); Martete Falls, Essequibo River, Guyana, S. Koi & N. Katayama GK-07 (TNS, AB698194); Kurupukari Falls, Essequibo River, Guyana, S. Koi & N. Katayama GK-10 (TNS, AB698195); Goldfast Rapids, Essequibo River, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-21 (TI, TNS, AB698196). Apinagia cf. riedelii Tul. – Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-116 (TI, TNS, AB698197); Tributary of Rio Claro near Caiaponia, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-136 (TI, TNS, AB698198); loc. cit., M. Kato, H. Okada & R. Imaichi BR-139 (TI, TNS, AB698199); C. T. Philbrick 5960 (HQ331544l). Apinagia surumuensis (Engl.) P. Royen – GU-18 (AB048367a). Apinagia yguazuensis Chodat & Vischer – waterfall near Iguaçu Waterfalls, Foz do Iguaçu, Brazil, M. Kato, Y. Kita & K. Suzuki BR-31 (TI, TNS, AB698200). Apinagia sp. – Rio Serragem II, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-10 (TI, TNS, AB698201); Salto do Ceu, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-23 (TI, TNS, AB698202); Rio Claro on BR060 near Jatai, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-120 (TI, TNS, AB698203); Balneario Municipal Saltinho, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-122 (TI, TNS, AB698204); Costa Rica, Rio Baucinho, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-128 (TI, TNS, AB698205); loc. cit., M. Kato, H. Okada & R. Imaichi BR-130 (TI, TNS, AB698206); Pantano waterfall near Caiaponia, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-143 (TI, TNS, AB698207); Esteito, Carolina, Maranhao, Brazil, R. Montana & L. F. Pozza BR-8002 (TNS, AB698208). Castelnavia monandra Tul. & Wedd. – C. T. Philbrick 5982 (HQ331567l). Ceratolacis pedunculatum C. T. Philbrick, Novelo & Irgang – C. T. Philbrick 5761 (HQ331568l). Cladopus austrosinensis M. Kato & Y. Kita – CH-301 (AB104560c); CH-302 (AB104559c). Cladopus doianus (Koidz.) Koriba – CH-02 (AB179654c); JK-02 (AB038189a); JK-Anraku c (AB038189 ); JK-Manose (AB179656c); JK-Mawatari (AB179655c); JK-Yamazaki (AB038189c); Channel from Omaru river, Kijo, Miyazaki, Japan, M. Kato & N. Katayama JP-127 (TI, TNS, AB698209). Cladopus fallax C. Cusset – Klong Kaeo waterfall, Bo Phloi village, Bo Rai, Trat, Thailand, S. Koi, R. Fujinami & T. Wongprasert TKF-109 (TI, TNS, AB698210); TL-701 (AB293561g); TL-1610 (AB537378k). Cladopus fukienensis (H. C. Chao) H. C. Chao – CH-01 (AB179653c); JK-03 (AB048371a). Cladopus javanicus M. Kato & Hambali – ID-02 (AB066175c). Cladopus nymanii H. Möller – Wae Garit river, Ruteng, Flores Island, Indonesia, Kato et al. FL-02 (TI, TNS, AB698211); ID-03 (AB104561c); S-01 (AB104577c). Cladopus pierrei C. Cusset – LK-117 (AB610213m); LK-121 (AB610214m); LK-123 (AB610215m); LK-128 (AB610219m); LK-132 (AB610220m); LK-134 (AB610221m); LK-211 (AB610224m); LK-214 (AB610225m); LK-221 (AB610226m); LK-222 (AB610227m); LK-232 (AB610228m); LK-237 (AB610222m); LK-241 (AB610223m); LKF-103 (AB537379k); LKF-109 (AB610217m); LKF-118 k (AB537380 ); LKF-120 (AB610218m). Cladopus queenslandicus (Domin) C. D. K. Cook & Rutish. – AU-01 (AB038199a); H. Akiyama 16803 (AB300702g). © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Nkam river, Kekem, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-20 (TNS, AB698175); Mawonge river, Ebone, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-28 (TNS, AB698176); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-29 (TNS, AB698177); Manengile village, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-31 (TNS, AB698178); CMR-33 (AB451723h); Ekouk river, Kolasongo, Loum, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-37 (TNS, AB698179); Chide river, Muambong village, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-40 (TNS, AB698180); Lobé waterfall, Bwambe, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-48A (TNS, AB698181); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-48B (TNS, AB698182); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-49 (TNS, AB698183); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-60 (TNS, AB698184); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-104 (TNS, AB698185); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-108 (TNS, AB698186); Kienke River, Kribi, Cameroon, S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-111 (TNS, AB698187); Sanaga River, near electric power station, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-121 (TNS, AB698188); Channel near electric power station, Sanaga River, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-123 (TNS, AB698189); Assock sóo, Nyong River, Ebogo, Mbalmayo, Cameroon, M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-127 (TNS, AB698190); loc. cit., M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-128 (TNS, AB698191); Sanaga River, Nachtigal, Cameroon, M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-132 (TNS, AB698192); C. T. Philbrick 6090 (HQ331691l); GH-01 (AB113739d); MD-03 (AB038198a); MD-str46 (AB113743d); MX-01 a (AB038197 ); MX-A (AB113741d); MX-B (AB113742d); TA-195 (AB113744d); TA-225 (AB113745d). MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE river, Panamaram, Wynad, Kerala, India, M. Kato, S. Koi & A. K. Pradeep KI-103 (TNS, AB698233); Bhimanadi, Kasaragod, Kerala, India, M. Kato, S. Koi, P. Mathew & A. K. Pradeep KI-114 (TNS, AB698234); Cheenganni Puzha near Iritti, Kannur, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-213 (TNS, AB698235); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-214 (TNS, AB698236). Hanseniella heterophylla C. Cusset – TL-311 (AB104562c); TL-1104 (AB537388k); TPK-13 (AB610229m); TPK-15 (AB610230m). Hydrobryopsis sessilis Engl. – KI-35 (AB048828a); Arippara waterfall, Kozhikode, Kerala, India, M. Kato, S. Koi & A. K. Pradeep KI-119 (TNS, AB698237); Thippalikayam near Alungalchattam, Palakkad, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-204 (TNS, AB698238); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-206 (TNS, AB698239); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-207 (TNS, AB698240). Hydrobryum austrolaoticum Koi & M. Kato – LK-116 (AB610232m); LK-122 (AB610233m); LK-125 (AB610234m); LKF-104 (AB537417k); LKF-106 (AB610231m); LKF-115 k (AB537418 ). Hydrobryum bifoliatum C. Cusset – TL-310 (AB104564c). Hydrobryum chiangmaiense M. Kato – TK-07 (AB537389k); TL-63 (AB048373a); Monthatharn waterfall, Doi Suthep National Park, Chiang Mai, Thailand, M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-430 (BKF, TI, TNS, AB698241); loc. cit., M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-431 (BKF, TI, TNS, AB698242); loc. cit., M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-432 (BKF, TI, TNS, AB698243); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1707 (BKF, TNS, AB698244); Wachiratharn waterfall, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, R. Imaichi, T. Santisuk & T. Wongprasert TL-64 (BKF, TI, TNS, AB698245); loc. cit., M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-421 (BKF, TI, TNS, AB698246); TL-65 (AB537390k); TL-422 (AB537391k); Siriphoom waterfall, near National Park Headquarters, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-423 (BKF, TI, TNS, AB698247); TL-424 (AB537392k); Pha Mon waterfall, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, S. Koi, Y. Kita & T. Wongprasert TL-425 (BKF, TI, TNS, AB698248); TL-428 (AB537393k); TL-429 (AB104570c); TL-801 (AB537394k); Siritharn waterfall, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-807 (BKF, TI, TNS, AB698249). Hydrobryum floribundum Koidz. – JK-Anraku2 (AB104571c); JK-Mae (AB104571c). Hydrobryum griffithii (Wall. ex Griff.) Tul. – CH-102 (AB104568c); TL-205 (AB104569c). Hydrobryum japonicum Imamura – CH-101 (AB104573c); JK-01 (AB038192a); J. Murata & al. 041232 (AB537396k); © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Cladopus taiensis C. Cusset – TL-101 (AB048372a); Wang Takrai Falls, Nakhon Nayok, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-102 (BKF, TI, TNS, AB698212); Nang Rong waterfall, Khao Yai National Park, Nakhon Nayok, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-604 (BKF, TI, TNS, AB698213). Diamantina lombardii Novelo, C. T. Philbrick & Irgang – C. T. Philbrick 5783 (HQ331591l); Cascatinha waterfall, Caraça, Minas Gerais, Brazil, M. Kato, H. Okada & R. Imaichi BR-101 (TNS, AB698214); Cristais waterfall, Diamantina, Minas Gerais, Brazil, M. Kato, H. Okada & R. Imaichi BR-114 (TNS, AB698215); Cascatinha waterfall, Parque Natural do Caraça, Minas Gerais, Brazil, R. Montana & L. F. Pozza BR-8006 (TNS, AB698216). Dicraeanthus africanus Engl. – Ameka & al. 02–07-07-02 (FN357239j); Sanaga River, Nachtigal, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-01 (TNS, AB698217); loc. cit., M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-130 (TNS, AB698218); Lobé waterfall, Bwambe, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-43 (TNS, AB698219); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-103 (TNS, AB698220); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-107 (TNS, AB698221); Nyong River, Dehane, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-53 (TNS, AB698222); Sanaga River, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-120 (TNS, AB698223); GHO-1413 (DQ168436f). Dicraeanthus cf. africanus Engl. – Sanaga River, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-125 (TNS, AB698224). Dicraeanthus zehnderi H. Hess – GHO-1650 (FM877834i); GHO-1651 (FM877836i). Dicraeanthus cf. zehnderi H. Hess – Sanaga River, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-122 (TNS, AB698225); loc. cit., R. Imaichi, S. Koi & N. Katayama CMR-126 (TNS, AB698226); Sanaga River, Nachtigal, Cameroon, M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-131 (TNS, AB698227). Djinga felicis C. Cusset – Fundong, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-14 (TNS, AB698228); Anyanjua River near Belo, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-16 (TNS, AB698229); GAR-021020-08 (DQ168433f); GAR-09 (HQ331593l). Djinga sp. – Mbo river, Manjo (Manengile), Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-35 (TNS, AB698230). Endocaulos mangorense (Perr.) C. Cusset – MD-02 (AB038191a). Farmeria metzgerioides Willis – Bhimanadi, Kasaragod, Kerala, India, M. Kato, S. Koi, P. Mathew & A. K. Pradeep KI-110 (TNS, AB698231); SL-07 (AB104580c); Mahaweli Ganga, Ivory Island, Kandy, Sri Lanka, M. Kato & N. Katayama SL-102 (TNS, AB698232). Griffithella hookeriana (Tul.) Warm. – C. T. Philbrick 4683 (HQ331612l); Kabbani 483 484 S. KOI ET AL. Pang Ma Pha, Mae Hongson, Thailand, M. Kato & T. Wongprasert TL-1203 (BKF, TI, TNS, AB698270); Hmopaeng waterfall, Pai, Mae Hongson, Thailand, M. Kato & T. Wongprasert TL-1204 (BKF, TI, TNS, AB698271); Tard Muey waterfall, Maetakhra National Park, Mae On, Chiang Mai, Thailand, M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1701 (BKF, TNS, AB698272); Vie1 (AB610236m). Hydrobryum kaengsophense M. Kato – TL-312 (AB104565c). Hydrobryum khaoyaiense M. Kato – Haew Narok waterfall, Khao Yai National Park, Nakhon Nayok, Thailand, R. Imaichi, R. Fujinami & T. Wongprasert TIF-53 (BKF, TNS, AB698273); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-26 (BKF, TNS, AB698274); TK-09 (AB537395k). Hydrobryum koribanum Imamura ex Nakayama & Minamitani – JK-05 (AB048374a). Hydrobryum loeicum M. Kato – Tard Huang international waterfall, Na Haew National Park, Loei, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-06 (BKF, TNS, AB698275); Chang Tok waterfall, Na Haew National Park, Loei, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-07 (BKF, TNS, AB698276); Khring waterfall, Loei, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-08 (BKF, TNS, AB698277); Khae stream, Loei, Thailand, M. Kato, S. Koi & T. Wongprasert TL-209 (BKF, TI, TNS, AB698278); TL-210 (AB104566c); TL-211 (AB537401k); Gang Ree, Huaylad, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-06 (BKF, TNS, AB698279); Gang Kongom, Huaylad, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-10 (BKF, TNS, AB698280). Hydrobryum micrantherum var. crassum M. Kato – TL-57 (AB038205a); TL-58 (AB104574c); TL-306 (AB104576c). Hydrobryum micrantherum var. micrantherum (P. Royen) C. D. K. Cook & Rutish. – TL-62 (AB104575c); Khao Soi Dao, Chanthaburi, Thailand, M. Kato, S. Koi & T. Wongprasert TL-1505 (BKF, TNS, AB698281). Hydrobryum phetchabunense M. Kato & Koi – TKF-01 (AB537414k); TL-1102 (AB537415k). Hydrobryum puncticulatum Koidz. – JK-Yaku (AB104572c). Hydrobryum ramosum (C. Cusset) Koi & M. Kato – LK-05 (AB537383k); LKF-05 (AB610237m). Hydrobryum somranii M. Kato – TL-703 (AB537402k); TL-704 (AB537403k). Hydrobryum subcrustaceum Koi & M. Kato – L-15 (AB537408k); LK-03 (AB537409k); LKF-02 (AB537410k); LKF-04 (AB537411k). Hydrobryum subcylindricum Koi & M. Kato – L-09 (AB537405k); L-13 (AB610238m); LKF-17 (AB537406k). Hydrobryum taeniatum Koi & M. Kato – L-08 (AB537404k); LK-107 (AB610239m). Hydrobryum takakioides Koi & M. Kato – L-14 (AB610240m); LK-202 (AB610241m); © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Nam Kad waterfall, Ban Faen, Oudom Xai, Laos, S. Koi, N. Katayama & T. Wongprasert LK-301 (TNS, AB698250); Nam Lueang stream, along the route 17A, 43 km from Muang Sing, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-302 (TNS, AB698251); Nam Lueang stream, along the route 17A, Ban Bone Xay, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-303 (TNS, AB698252); stream at entrance of Phagneung Phoukulom waterfall, along the route 17A, 17 km from Muang Sing, Nam Ha National Protected Area, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-304 (TNS, AB698253); stream under the bridge on the route 17A, at the border of Nam Ha National Protected Area, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-305 (TNS, AB698254); stream along the route 17B, 17 km from Muang Sing, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-306 (TNS, AB698255); stream along the route 17B, Ban Kang Kao, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-308 (TNS, AB698256); stream, Ban Ta Pha, Bokeo, Laos, S. Koi, N. Katayama & T. Wongprasert LK-318 (TNS, AB698257); Pa La-U waterfall, Kaeng Krajan National Park, Phetchaburi, Thailand, R. Imaichi, R. Fujinami & T. Wongprasert TIF-115 (BKF, TNS, AB698258); TK-01 (AB610235m); Huay Kaew stream, Maetakhra National Park, Mae On, Chiang Mai, Thailand, S. Koi & T. Wongprasert TK-03 (BKF, TNS, AB698259); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1702 (BKF, TNS, AB698260); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1705 (BKF, TNS, AB698261); Mork Fa fall, Doi Suthep Pui National Park, Chiang Mai, Thailand, S. Koi & T. Wongprasert TK-08 (BKF, TNS, AB698262); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1708 (BKF, TNS, AB698263); None Phatana village, Phu Luang Wildlife Reservation, Leoi, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-09 (BKF, TNS, AB698264); Mae Nam Fang National Park, Chiang Mai, Thailand, M. Kato, S. Koi & T. Wongprasert TL-206 (BKF, TI, TNS, AB698265); TL-415 (AB537397k); TL-420 (AB537398k); TL-427 k (AB537399 ); Mae Pan waterfall, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, S. Koi, Kita & T. Wongprasert TL-426 (BKF, TI, TNS, AB698266); Mae Wang stream, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, R. Imaichi, S. Koi & T. Wongprasert TL-1004 (BKF, TI, TNS, AB698267); Mae Laka river, Ban Nong Haeng, Khoon Yuam, Mae Hongson, Thailand M. Kato, R. Imaichi, S. Koi & T. Wongprasert TL-1006 (BKF, TI, TNS, AB698268); TL-1103 (AB537400k); Sobwak village, Mae Chaem, Chiang Mai, Thailand, M. Kato & T. Wongprasert TL-1201 (BKF, TI, TNS, AB698269); MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE AB698297); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-102 (TNS, AB698298); Kienke River, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-58 (TNS, AB698299); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-110 (TNS, AB698300); GAR-021018-02 (DQ168432f); GHO-1414 (DQ168442f). Inversodicraea (= Ledermanniella) ntemensis Y. Kita, Koi, Rutish. & M. Kato – Ntem River, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-65 (TNS, AB698301); ‘M’ve’ele waterfall, Campo Ma’an, Cameroon, S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-114 (TNS, AB698302). Jenmaniella ceratophylla Engl. – Potaro River, Tumatumari, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-17 (TI, TNS, AB698303). Ledermanniella bifurcata (Engl.) C. Cusset – Nyong River, Dehane, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-51 (TNS, AB698304); Kienke River, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-56 (TNS, AB698305); Lokoundje River, Lolodorf, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-62 (TNS, AB698306); Langke River, Gabon, M. Kato, R. Imaichi & S. Koi GB-10 (TNS, AB698307); GHO-1597 (DQ168439f). Ledermanniella bowlingii (J.B. Hall) C. Cusset – Ameka 501 (FN357242j); Ameka 502 (FN357243j); AR-021010 (DQ168429f); Asuboni River, Kwahu-Nteso, Ghana, Y. Kita & G. K. Ameka s.n. (TNS, AB698308). Ledermanniella keayi (G. Taylor) C. Cusset – Vi River, Kumbo, Bamenda, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-10A (TNS, AB698309); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-10B (TNS, AB698310). Ledermanniella letouzeyi C. Cusset – Ngombo waterfall, Muambong, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-41 (TNS, AB698311); GAR-021023-12 (DQ168435f). Ledermanniella linearifolia Engl. – Ameka & al. 02–07-07-04 (FN357246j); Ameka & al. 02–07-07–13 (FN357245j); Lobé waterfall, Bwambe, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-44A (TNS, AB698312); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-44B (TNS, AB698313); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-101 (TNS, AB698314); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-106 (TNS, AB698315); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-109 (TNS, AB698316); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-116 (TNS, AB698317); loc. cit., S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-119 (TNS, AB698318); GHO-1415 (DQ168437f). Ledermanniella onanai Cheek – Mamuwata water- © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 LKF-16 (AB537407k). Hydrobryum tardhuangense M. Kato – LK-113 (AB610242m); TL-208 (AB104567c). Hydrobryum verrucosum Koi & M. Kato – L-07 (AB537412k); L-12 (AB610243m); LK-105 (AB610244m); LKF-14 (AB537413k). Hydrobryum vientianense (M. Kato & Fukuoka) Koi & M. Kato – L-01 (AB537384k); L-02 (AB610245m); L-16 (AB537385k); LK-06 (AB537386k); LK-07 (AB610246m); LK-08 (AB537387k); TKF-02 (AB537416k); Namthob station, Phu Luang Wildlife Sanctuary, Loei, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-04 (BKF, TNS, AB698282); loc. cit., L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-24 (BKF, TNS, AB698283); TPK-26A (AB610247m); TPK-26B (AB610248m); TPK-28 (AB610249m); TPK-29 (AB610250m). Hydrobryum sp. – Nam Tha river at the bridge 24 km from Luang Namtha, near Ban Sop Shin, Nam Ha National Protected Area, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-313 (TNS, AB698284); loc. cit., S. Koi, N. Katayama & T. Wongprasert LK-314 (TNS, AB698285); loc. cit., S. Koi, N. Katayama & T. Wongprasert LK-315 (TNS, AB698286); Nam Tha river, Ban Sin Oudom, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-316 (TNS, AB698287); Nam Tha river, Ban Sloy, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-317 (TNS, AB698288); TPK-01 (AB610253m); TPK-16 m (AB610251 ); TPK-22 (AB610252m). Hydrodiscus koyamae (M. Kato & Fukuoka) Koi & M. Kato – L-06 (AB537381k); L-11 (AB537382k); LK-104 (AB610255m); LKF-13 (AB610254m). Inversodicraea annithomae C. Cusset – Ameka & al. 02–07-07–10 (FN357240j); Ameka & al. 02–07-07–12 (FN357241j). Inversodicraea cf. annithomae (C. Cusset) R. Rutish. & Thiv – GAHR-23 (HQ331633l). Inversodicraea bosii C. Cusset – Lobé River, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-47 (TNS, AB698289); GAR021018-01 (DQ168431f). Inversodicraea cristata Engl. – Mawongge River, en route to Maujo, south of Nkongsanmba, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-27 (TNS, AB698290); GHO-1659 (FM877837i); GHO-1664 (FM877838i); GHO-1666 (FM877839i). Inversodicraea cf. kamerunensis Engl. – Kienke River, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-59 (TNS, AB698291); Langke River, Gabon, M. Kato, R. Imaichi & S. Koi GB-11 (TNS, AB698292); loc. cit., M. Kato, R. Imaichi & S. Koi GB-12 (TNS, AB698293); loc. cit., Gabon, M. Kato, R. Imaichi & S. Koi GB-13 (TNS, AB698294). Inversodicraea ledermannii Engl. – Ameka & al. 02–07-07-06 (FN357244j); Lobé waterfall, Bwambe, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-45A (TNS, AB698295); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-45B (TNS, AB698296); loc. cit., R. Imaichi, Y. Kita & J.-P. Ghogue CMR-46 (TNS, 485 486 S. KOI ET AL. AB698339); C. T. Philbrick 6093 (HQ331666l). Mourera fluviatilis Aubl. – Head Falls, Essequibo River, Hipaia, Guyana, S. Koi & N. Katayama GK-01 (TNS, AB698340); Martete Falls, Essequibo River, Iwokrama, Guyana, S. Koi & N. Katayama GK-08 (TNS, AB698341); Goat (Gold) Falls, Essequibo River, Iwokrama, Guyana, S. Koi & N. Katayama GK-09A (TNS, AB698342); loc. cit, S. Koi & N. Katayama GK-09B (TNS, AB698343); Kurupukari Falls, Essequibo River, Iwokrama, Guyana, S. Koi & N. Katayama GK-12 (TNS, AB698344); GU-24 (AB038200a). Mourera sp. – Salto Maciel, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-19B (TNS, AB698345); Noveloa coulteriana (Tul.) C. T. Philbrick – C. T. Philbrick 6270 (HQ331667l); MX-07 (AB048375a). Paracladopus chanthaburiensis Koi & M. Kato – TIK-21 (AB293559g); TIK-34 (AB300701g); Klong Yai, Pong Nam Ron, Chanthaburi, Thailand, S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-24 (BKF, TNS, AB698346); TL-1533 (AB293558g). Paracladopus chiangmaiensis M. Kato – LK-213 (AB610258m); LK-220 (AB610259m); LK-223 m (AB611703 ); LKF-105 (AB610256m); LKF-110 (AB537419k); LKF-116 (AB610257m); LKF-119 (AB537420k); LKF-121 (AB537421k); TL-808 (AB293560g); TL-1706 (AB537422k); Lao river near Mae Khachan Hot Spa, Chiang Mai, Thailand, S. Koi, N. Katayama & T. Wongprasert TK-201 (TNS, AB698347); Bu Gia Map National Park, Vietnam, S.-W. Chung s.n. (Vie2) (TAIF, AB698348). Podostemum ceratophyllum Michx. – CTP-4615 (DQ168440f); Cusick 30042 (EF135584e); Kajita 99072501 (AB038203a); Ruhfel s.n. (HQ331671l). Podostemum distichum Wedd. – Brotas waterfall, São Paulo, Brazil, M. Kato, Y. Kita & K. Suzuki BR-02 (TI, TNS, AB698349); Pocinhos waterfall, Caldas, Minas Gerais, Brazil, M. Kato, H. Okada & R. Imaichi BR-112 (TNS, AB698350); Costa Rica, Baucinho, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-127 (TNS, AB698351). Podostemum rutifolium subsp. ricciforme (Liebm.) A. Novelo & C. T. Philbrick – MX-08 (AB038201a). Podostemum rutifolium subsp. rutifolium Warm. – waterfall near Iguaçu waterfalls, Foz do Iguaçu, Brazil, M. Kato, Y. Kita & K. Suzuki BR-30 (TI, TNS, AB698352); Novelo 3979 (DQ168441f). Podostemum saldanhanum (Warm.) C. T. Philbrick & Novelo – Quebra Frasco, Rio de Janeiro, Brazil, M. Kato, Y. Kita & K. Suzuki BR-04 (TNS, AB698353); Rio Formoso, Rio de Janeiro, Brazil, M. Kato, Y. Kita & K. Suzuki BR-14 (TNS, AB698354). Podostemum scaturiginum (Mart.) C. T. Philbrick & Novelo – Rio Claro, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-117 (TNS, AB698355); C. T. Philbrick et al. 5602 (HQ331672l). Podostemum weddellianum (Tul.) C. T. Philbrick & Novelo – Pocinhos waterfall, Caldas, Minas Gerais, Brazil, M. Kato, H. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 fall, Apouh, Fongo Tango, Dschang, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-24 (TNS, AB698319); Chide River, Muambong, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-39 (TNS, AB698320). Ledermanniella pellucida (Engl.) C. Cusset – Manengile, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-30 (TNS, AB698321); Mbo River, Manjo (Manengile), Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-34 (TNS, AB698322). Ledermanniella pusilla (Warm.) C. Cusset – Ameka & al. 02–07-07-07 (FN357247j); Kienke River, Kribi, Cameroon, S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-112 (TNS, AB698323); GAHR-17 (HQ331646l). Ledermanniella sanagaensis C. Cusset – Sanaga River, Nachtigal, Cameroon, M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-134 (TNS, AB698324). Ledermanniella cf. schlechteri (Engl.) C. Cusset – Kienke River, Kribi, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-57 (TNS, AB698325). Ledermanniella sp. – waterfall on route from Tuba to Ndop, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-12 (TNS, AB698326); Fundong, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-13A (TNS, AB698327); Ling Gang-foto, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-23 (TNS, AB698328). Leiothylax quangensis (Engl.) Warm. – GHO-1667 (FM877842i). Letestuella tisserantii G. Taylor – Sanaga River, Nachtigal, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-02 (TNS, AB698329); loc. cit., M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-133 (TNS, AB698330); GHO-1660 (FM877840i). Macropodiella heteromorpha (Baill.) C. Cusset – Ameka & al. 02–07-07–08 (FN357248j); Ameka & al. 02–07-07–09 (FN357249j); Ntem River, Cameroon, R. Imaichi, Y. Kita & J.-P. Ghogue CMR-66 (TNS, AB698331); ‘M’ve’ele waterfall, Campo Ma’an, Cameroon, S. Koi, N. Katayama, R. Rutishauser, K. Huber, G. K. Ameka & J.-P. Ghogue CMR-113 (TNS, AB698332); GAHR-24 (HQ331649l). Macropodiella cf. heteromorpha (Baill.) C. Cusset – Ogooué River, Booué, Gabon, M. Kato, R. Imaichi & S. Koi GB-01 (TNS, AB698333); loc. cit., M. Kato, R. Imaichi & S. Koi GB-03 (TNS, AB698334); loc. cit., M. Kato, R. Imaichi & S. Koi GB-04 (TNS, AB698335); loc. cit., M. Kato, R. Imaichi & S. Koi GB-05 (TNS, AB698336); loc. cit., M. Kato, R. Imaichi & S. Koi GB-09 (TNS, AB698337). Marathrum foeniculaceum Bonpl. – C. T. Philbrick 5958 (WCSU, HQ331658l); MX-02 (AB038195a). Marathrum plumosum (Novelo & C. T. Philbrick) C. T. Philbrick & C. P. Bove – MX-05 (AB048378a). Monandriella linearifolia Engl. – GHO-1663 (HQ331658l). Monostylis capillacea Tul. – Salto Maciel, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-21 (TI, TNS, AB698338); C. T. Philbrick 6076 (HQ331663l). Mourera cf. aspera Tul. – Salto Maciel, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-17 (TNS, MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE pattayanon, S. Koi & T. Wongprasert TPK-19 (BKF, TNS, AB698374); TPK-20 (AB610274m); Huai Phai waterfall, Phu Rua National Park, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-21 (BKF, TNS, AB698375). Polypleurum prachinburiense M. Kato & Koi – TL-1404 (AB610275m); Kaeng Hin Phoeng waterfall, Khao Yai National Park, Na Dee, Prachinburi, Thailand, R. Imaichi, S. Nishida, S. Koi, R. Fujinami & T. Wongprasert TIK-20 (BKF, TNS, AB698376); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1534 (BKF, TNS, AB698377); loc. cit., M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1601-2 (BKF, TNS, AB698378); loc. cit., M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1601-3 (BKF, TNS, AB698379); loc. cit., M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1603 (BKF, TNS, AB698380); loc. cit., M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1604 (AB610278m); TL-1601-1 (AB610276m); TL-1602 (AB610277m); Takro waterfall, Khao Yai National Park, Prachinburi, Thailand, M. Kato, S. Koi, C. Tsutsumi, N. Katayama & T. Wongprasert TL-1612 (BKF, TNS, AB698381). Polypleurum schmidtianum Warm. – LK-106 (AB610279m); Saphan Hin waterfall, Trat, Thailand, R. Imaichi, S. Nishida, S. Koi, R. Fujinami & T. Wongprasert TIK-22 (BKF, TNS, AB698382); loc. cit., R. Imaichi, S. Nishida, S. Koi, R. Fujinami & T. Wongprasert TIK-23 (BKF, TNS, AB698383); TKF-21 (AB610463m); Sato stream, Klong Sato, Bo Rai, Trat, Thailand, S. Koi, R. Fujinami & T. Wongprasert TKF-106 (BKF, TNS, AB698384); TL-1303 (AB610280m); TL-1508A (AB610281m); TL-1508B (AB610282m); Tharn Mayom waterfall, Ko Chang, Trat, Thailand, M. Kato, S. Koi & T. Wongprasert TL-1527 (BKF, TNS, AB698385). Polypleurum sisaketense M. Kato & Koi – TL-1502 (AB610464m). Polypleurum stylosum (Wight) J. B. Hall – A. K. Pradeep 90003 (AB610465m); Chaithravahinipuzha, Ponganchal, Eleri Panihayath, Hosdurg Taluk, Kasaragod, Kerala, India, M. Kato & R. Imaichi KI-25 (TI, TNS, AB698386); KI-109 (AB610466m); KI-211 (AB610467m); Pooyam Kutty river, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-217 (TNS, AB698387); KI-222 (AB610468m); SL-05 (AB066174c); Mahaweli Ganga, Ivory Island, Kandy, Sri Lanka, M. Kato & N. Katayama SL-103 (TNS, AB698388); loc. cit., M. Kato & N. Katayama SL104 (TNS, AB698389). Polypleurum wallichii var. wallichii (R. Br. ex Griff.) Warm. – L-03 (AB610470m); LK-09 (AB610471m); LK-127 (AB610472m); LK-238 (AB610473m); TL-55 (AB038204a); TL-601 m (AB610469 ). Polypleurum wongprasertii M. Kato – TL-319 (AB104579c). Rhyncholacis cf. apiculata P. Royen – Crab Falls, Mazaruni River, Guyana, S. Koi & N. Katayama GK-03 (TNS, AB698390). Rhynchola- © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Okada & R. Imaichi BR-110A (TNS, AB698356). Podostemum cf. weddellianum (Tul.) C. T. Philbrick & Novelo – Serra dos Órgãos, en route from Petropolis to Teresopolis, Rio de Janeiro, Brazil, M. Kato, Y. Kita & K. Suzuki BR-03 (TNS, AB698357); Rio Soberbo, Rio de Janeiro, Brazil, M. Kato, Y. Kita & K. Suzuki BR-08 (TNS, AB698358). Podostemum sp. – Rio de Janeiro, Brazil, M. Kato, Y. Kita & K. Suzuki BR-06B (TNS, AB698359). Polypleurum elongatum (Gardn.) J. B. Hall – SL-12 (AB048376a). Polypleurum erectum M. Kato – TL-706 (AB610260m). Polypleurum insulare M. Kato & Koi – Khlong Phu waterfall, Ko Chang, Trat, Thailand, M. Kato, S. Koi & T. Wongprasert TL-1304 (BKF, TNS, AB698360); TL-1512 (AB610261m); Tharn Mayom waterfall, Ko Chang, Trat, Thailand, M. Kato, S. Koi & T. Wongprasert TL-1521 (BKF, TNS, AB698361); loc. cit., M. Kato, S. Koi & T. Wongprasert TL-1526 (BKF, TNS, AB698362). Polypleurum longicaule M. Kato – Tharn Ngam waterfall, Ubon Thani, Thailand, M. Kato & T. Wongprasert TL-708 (BKF, TI, TNS, AB698363); TL-709 (AB610262m); TL-901 (AB610263m); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-10A (BKF, TNS, AB698364); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-10B (BKF, TNS, AB698365); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-10C (BKF, TNS, AB698366); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-11A (BKF, TNS, AB698367); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-11B (BKF, TNS, AB698368); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-12 (BKF, TNS, AB698369); loc. cit., S. Koi, R. Fujinami, N. Katayama & T. Wongprasert TKF-13 (BKF, TNS, AB698370). Polypleurum longifolium M. Kato – TL-707 (AB610264m); TL-904 (AB610265m). Polypleurum longistylosum M. Kato – TL-318 (AB104578c); TL-1503 (AB610266m). Polypleurum munnarense Nagendran & Arekal – A. K. Pradeep 90004 (AB610267m); Karappara River, Muthuvarachal, Parambikulam Wildlife Sanctuary, Trichur, Kerala, India, A. K. Pradeep 90007 (TNS, AB698371). Polypleurum phuwuaense M. Kato – TL-705 (AB610268m). Polypleurum pluricostatum Koi & M. Kato – LK-01 (AB610269m); LK-02 (AB610270m); LK-04 (AB610271m); LKF-01 (AB610272m); LKF-03 (AB610273m); Huai Toei waterfall, Phu Rua National Park, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-17 (BKF, TNS, AB698372); Hin Sam Chan waterfall, Phu Rua National Park, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-18 (BKF, TNS, AB698373); Lead Phob waterfall, Phu Rua National Park, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Satha- 487 488 S. KOI ET AL. non National Park, Chiang Mai, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-804 (BKF, TNS, AB698413); Mae Wang stream, Doi Inthanon National Park, Chiang Mai, Thailand, M. Kato, R. Imaichi & T. Wongprasert TL-809 (BKF, TNS, AB698414); TPK-02 (AB610474m); TPK-04 (AB610475m); Gang Ree, Huaylad, Dansai, Loei, Thailand, L. Ampornpan, P. Werukamkul, W. Sumanochitrapon, A. Sathapattayanon, S. Koi & T. Wongprasert TPK-07 (BKF, TNS, AB698415); TPK-14 (AB610476m). Thelethylax minutiflora (Tul.) C. Cusset – MD-01 (AB038196a); Ambanjazamba river, Ambody-port, Antsirabe de Nord, Antsiranana, Madagascar, R. Imaichi et al. MD-4563 (TNS, AB698416). Wettsteiniola cf. pinnata Suess – Rio Claro near Jatai, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-119 (TI, TNS, AB698417). Willisia arekaliana Shivam. & K. B. Sadanand – Meenmutty waterfall, Aralam Wildlife Sanctuary, Kannur, Kerala, India, A. K. Pradeep 93196 (TNS, AB698418). Willisia selaginoides (Bedd.) Warm. ex J. C. Willis – Karappara river, Muthuvarachal, Parambikulam Wildlife Sanctuary, Trichur, Kerala, India, A. K. Pradeep 90006A (TNS, AB698419); loc. cit., A. K. Pradeep 90006B (TNS, AB698420); loc. cit., A. K. Pradeep 90006C (TNS, AB698421). Winklerella dichotoma Engl. – Sanaga River, Edéa, Cameroon, R. Imaichi, S. Koi & N. Katayama CMR-124 (TNS, AB698422). Zeylanidium lichenoides (Kurz.) Engl. – KI-37 (AB104582c); Panathur, Kasaragod, Kerala, India, M. Kato, S. Koi, P. Mathew & A. K. Pradeep KI-108 (TNS, AB698423); Huay Kaew stream, Maetakhra National Park, Mae On, Chiang Mai, Thailand, S. Koi & T. Wongprasert TK-02 (BKF, TNS, AB698424); loc. cit., S. Koi & T. Wongprasert TK-04 (BKF, TNS, AB698425); loc. cit., S. Koi & T. Wongprasert TK-05 (BKF, TNS, AB698426); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1703 (BKF, TNS, AB698427); loc. cit., M. Kato, C. Tsutsumi, Y. Hirayama, N. Katayama & T. Wongprasert TL-1704 (BKF, TNS, AB698428). Zeylanidium maheshwarii C. J. Mathew & V. K. Satheesh – KI-34 (AB048379a). Zeylanidium olivaceum Engl. – SL-09 (AB038207a); SL-14 (AB104581c). Zeylanidium subulatum (Gardner) C. Cusset – KI-219 (AB610477m), SL-01 (AB038202a). Zeylanidium sp. – Thippalikayam near Alungalchattam, Palakkad, Kerala, India, A. K. Pradeep 90001 (TNS, AB698429); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-202 (TNS, AB698430); loc. cit., M. Kato, N. Katayama & A. K. Pradeep KI-208 (TNS, AB698431); Pooyam Kutty river near Kothamanglam, Ernakuram, Kerala, India, M. Kato, N. Katayama & A. K. Pradeep KI-216 (TNS, AB698432). Specimen incertae sedis – Salto Maciel, Mato Grosso, Brazil, M. Kato, Y. Kita & K. Suzuki BR-20 (TNS, AB698433); San Gabriel da Cachoeira, Amazonas, Brazil, M. Kato, Y. Kita & K. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 cis cf. linearis Tul. – San Gabriel da Cachoeira, Amazonas, Brazil, M. Kato, Y. Kita & K. Suzuki BR-26 (TI, TNS, AB698391). Rhyncholacis cf. oligandra – Kurupukari Falls, Essequibo River, Iwokrama, Guyana, S. Koi & N. Katayama GK-11 (TNS, AB698392); loc. cit., S. Koi & N. Katayama GK-13 (TNS, AB698393); downstream of Kurupukari Falls, Essequibo River, Iwokrama, Guyana, S. Koi & N. Katayama GK-15 (TNS, AB698394). Rhyncholacis cf. penicillata Matthiesen – Papikai Falls, Mazaruni River, Guyana, M. Hasebe & S. Koi GHK-01 (TNS, AB698395); Parika Falls, Cuyuni River, Guyana, M. Hasebe & S. Koi GHK-02 (TNS, AB698396). Rhyncholacis sp. – Amaral s.n. (EF135564l); Correheira, Santa Barbara, Amazonas, Brazil, M. Kato, Y. Kita & K. Suzuki BR-28 (TI, TNS, AB698397); Apakash Falls, Mazaruni River, Guyana, M. Hasebe & S. Koi GHK-04 (TNS, AB698398); loc. cit., M. Hasebe & S. Koi GHK-05 (TNS, AB698399); loc. cit., M. Hasebe & S. Koi GHK06 (TNS, AB698400); Moses Falls, Essequibo River, Guyana, M. Hasebe & S. Koi GHK-07 (TNS, AB698401); Puppikai Falls, Mazaruni River, Guyana, S. Koi & N. Katayama GK-06 (TNS, AB698402); Head Falls, Essequibo River, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-04 (TI, TNS, AB698403); Maripa Falls, Mazaruni River, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-08 (TI, TNS, AB698404); Potaro River, Tumatumari, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-11 (TI, TNS, AB698405); Matope Falls, Cuyuni River, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-26 (TI, TNS, AB698406). Saxicolella agumatsa Ameka & Cheek – Ameka 478 (FN357250j); Ameka 479 (FN357251j). Saxicolella amicorum J. B. Hall – Ameka & deGraft-Johnson 112 (FN357252j); Ameka & deGraft-Johnson 113 (FN357253j). Saxicolella nana Engl. – Assock sóo, Nyong River, Ebogo, Mbalmayo, Cameroon, M. Kato, R. Imaichi, S. Koi & N. Katayama CMR-129 (TNS, AB698407). Stonesia ghoguei E. Pfeifer & Rutish. – GHO-1665 (FM877841i). Thawatchaia trilobata M. Kato, Koi & Y. Kita – stream along the route 17B, between Ban Houay Mo and Ban Kang Kao, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-307 (TNS, AB698408); stream along the route 17B, Ban Kang Kao, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-309 (TNS, AB698409); Nam Tha river, Ban Soptout, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-310 (TNS, AB698410); Nam Tha river at the bridge 24 km from Luang Namtha, near Ban Sop Shin, Nam Ha National Protected Area, Luang Namtha, Laos, S. Koi, N. Katayama & T. Wongprasert LK-312 (TNS, AB698411); Houay Kalok stream, Bokeo, Laos, S. Koi, N. Katayama & T. Wongprasert LK-319 (TNS, AB698412); TL-419 (AB104563c); Wang Kwai waterfall, Doi Intha- MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE Suzuki BR-27 (TI, TNS, AB698434); Cascatona waterfall, Caraca, Minas Gerais, Brazil, M. Kato, H. Okada & R. Imaichi BR-103 (TNS, AB698435); Vale do Paraiso, Alenquer, Pará, Brazil, R. Montana & L. F. Pozza BR-8001 (TNS, AB698436); Ogooué River, Booué, Gabon, M. Kato, R. Imaichi & S. Koi GB-02 (TNS, AB698437); loc. cit., M. Kato, R. Imaichi & S. Koi GB-06 (TNS, AB698438); loc. cit., M. Kato, R. Imaichi & S. Koi GB-07 (TNS, AB698439); loc. cit., M. Kato, R. Imaichi & S. Koi GB-08 (TNS, AB698440). SAMPLES/1 SPECIES/1 GENUS) Weddellina squamulosa Tul. – C. T. Philbrick 5827 (HQ331841l); Crab Falls, Mazaruni River, Guyana, S. Koi & N. Katayama GK-02 (TNS, AB698441); Sarin Falls, Mazaruni River, Guyana, S. Koi & N. Katayama GK-04 (TNS, AB698442); Puppikai Falls, Mazaruni River, Guyana, S. Koi & N. Katayama GK-05 (TNS, AB698443); Head Fall, Essequibo River, Guyana, M. Kato, H. Okada, R. Imaichi, Y. Kita & K. Suzuki GU-03 (TI, TNS, AB698444); GU-20 (AB038206a). Weddellina cf. squamulosa – Sereno waterfall, Rio do Monte near Caiaponia, Goias, Brazil, M. Kato, H. Okada & R. Imaichi BR-144 (TNS, AB698445). OUTGROUP (SELECTED MEMBERS CLUSIOID MALPIGHIALES) OF Clusia cruiva Cambess. (Clusiaceae) – SK08071206 (AB450037h). Cratoxylum ligustrinum Blume (Hypericaceae) – SK08071203 (AB450036h). Hypericum calycinum L. (Hypericaceae) – Ikoma, Nara, Japan, S. Koi SK090615 (TNS, AB698446). Hypericum perforatum L. (Hypericaceae) – Research Center for Medicinal Plant Resources, National Institute of Biomedical Innovation, Tsukuba, Japan, HK-138 (TNS, AB698447). Calophyllum sp. (Calophyllaceae) – Tat Namsanam waterfall, Ban Khounkham, Ban Namsanam Hinboun, Khammouane, Laos, S. Koi, N. Katayama & T. Wongprasert LK-114 (TNS, AB698448). Sources: aKita & Kato (2001); bKato et al. (2003); c Kita & Kato (2004a); dKita & Kato (2004b); eDavis & Wurdack (2004); fMoline et al. (2007); gKoi et al. (2008); hKoi et al. (2009); iThiv et al. (2009); jKelly et al. (2010); kKoi & Kato (2010a); lRuhfel et al. (2011); m Koi & Kato (in press). APPENDIX 2 PRIMERS USED IN THIS STUDY Name Sequence (5′–3′) Direction Source Amplification 3914F trnK-2R MK-2rR PodMK-F(p.w.d) PodMK-F(t) PodMK-R TGGGTTGCTAACTCAAYGG AACTAGTCGGATGGAGTAG GTCGGGATGGAGTAGATAATWTA TATCGCACTAYGTATCAKTT TATCGCACTATGTATCCGTT TATCGCACACGGCTTTC F R R F F R Johnson & Soltis (1994) Johnson & Soltis (1994) Koi et al. (2008) This study This study This study Amplification and sequencing HpMK-F1 HpMK-R1 CTCATTGGGGAAGTTGCATT AAAAGGTTCCCAAAAATCCG F R This study This study Sequencing MK-F1 MK-R1 MK-F2 MK-F2seq MK-R2 MK-2rRseq MK-F3 MK-R3 MK-R4 Pod7Rnew MK-F11 MK-R12 MK-F13 MK-F14 MK-F15 TTTCCAAAARCAAAAGAGCG GCTWCGTAGTGCGATAGAGTCA TGATTCAAATTCTTCGTTACTGG CTTCGTTACTGGTTAAAAGATT CAAWCTGCAATAGAAAGACTCAAA CTTWCCCTACGTAAACATCCA ATATTATTGACCGATTTGTGCG GAAAGAAWTGGCGACGAATAA GAGGTTTTATGTTTACGAGCCA AATTTTCCTTGATAMCGAATATAATG TTACAATCAATTCATTCAATATT ATCATTAATAGAAAGAATATC TGGATTCCGATATTATTGACCG CAGATTGCTTCTTTGATCTTCC ACTCTATCGCACTATGTATC F R F F R R F R R R F R F F F Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi Koi © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 et al. (2008) & Kato (2010a) et al. (2008) & Kato (2010a) et al. (2008) et al. (2008) et al. (2008) et al. (2008) et al. (2008) et al. (2008) et al. (2009) et al. (2009) et al. (2009) et al. (2009) et al. (2009) Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 WEDDELLINOIDEAE (7 489 490 S. KOI ET AL. APPENDIX 2 Continued Name Direction Source CAAAATTTACAATCAATTCA TATATATATGAATACGAATC GTCTGGTTTCAACCMGAYAA TAYTCATGAAGAAASAATCG GAYAATGATTCAATYATTGG GAAAGAATATCCAAATACCA AAATGGAATATTCAATTAGT TCAATAAATCCTAACTATTC ATGTATCAACARAATCATTT TCAATTCATTCMATWTTTCC AAGACCCNAATATGMATTAT TCATATTWTTATAGTGGATC CTTTCCCTACGTAAACATCC GAGGTTTTGTGTTTVCGAGC GTAACRAARTAGTATTTCCA GGRTAAGGGAATAAMCCATC TTCCAATACTCGTGAAAAAA ATRMTAGTTCCAATTATTCT AATATCCAAATACCAAACCC YCATCCTTTTTAGAAGAATT ATGGTTCCAATTCCAATACT CATCYTTTTTAGARGAATTATT GATCATTAATAGAAATAATATC AGACTTTATTTCTATGGAAAAGTAGA GTATCAAATACATTATATACTTCG CTATAAWAATATGAAATCTTATTGCATAG CATTATATTCGATATCAAGG GGTTTGCTAAYGGGATGTCC ACTTCAAAAATACCATGTCC TGAATTGATTGTAAATTTTG F F F R R R R F F F F F R R R R R F R F R F R F F R F R F R Koi et al. (2009) This study Koi et al. (2009) Koi et al. (2009) Koi et al. (2009) This study Koi et al. (2009) This study Koi & Kato (2010a) This study Koi & Kato (2010a) Koi & Kato (2010a) Koi & Kato (2010a) Koi & Kato (2010a) Koi & Kato (2010a) Koi & Kato (2010a) This study This study Koi & Kato (2010a) This study This study This study This study This study Koi & Kato (2010a) Koi & Kato (2010a) This study This study This study This study APPENDIX 3 Expected amount of change per site (= branch length in Fig. 2A–C) inferred with RAxML analysis between subclades of Tristicha trifaria, between subclades of Terniopsis and between Indodalzellia, Indotristicha and Dalzellia. T. trifaria T. trifaria Afro-American T. trifaria Afro-Madagascan T. trifaria African Indodalzellia Indotristicha Dalzellia Terniopsis ‘sessilis’ Terniopsis ‘Lao-Thai’ Terniopsis ‘chanthaburiensis’ Terniopsis ‘malayana’ Terniopsis Af-Am Af-Md Af Indodal Indotri Dal ‘ses’ ‘L-T’ ‘chan’ 0.025 0.068 0.152 0.149 0.155 0.196 0.194 0.213 0.199 0.050 0.134 0.131 0.137 0.178 0.176 0.195 0.181 0.150 0.147 0.153 0.194 0.192 0.211 0.197 0.045 0.051 0.183 0.181 0.200 0.186 0.038 0.180 0.178 0.197 0.183 0.186 0.183 0.203 0.188 0.023 0.052 0.038 0.050 0.035 0.039 ‘mal’ Af-Am, Afro-American; Af-Md, Afro-Madagascan; Af, African; Indodal, Indodalzeilla; Indotri, Indotristicha; Dal, Dalzellia; ‘ses’, ‘sessilis’; ‘L-T’, ‘Lao-Thai’, ‘chan’, ‘chanthaburiensis’; ‘mal’, ‘malayana’. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 MK-F16 MK-17F MK-F18 MK-R19 MK-R20 MK-21R MK-R22 MK-23F MK-24F MK-25F MK-26F MK-27F MK-28R MK-29R MK-30R MK-31R MK-35R MK-36F MK-37R MK-38F MK-39R MK-41F MK-42R PpMK-101F MK-102F MK-103R PMK-104F PtMK-105R PtMK-106F PMK-107R Sequence (5′–3′) MOLECULAR PHYLOGENETIC ANALYSIS OF PODOSTEMACEAE 491 APPENDIX 4 Morphological characters of species of Asian clade used in this study*. 2 3 4 5 6 7 8 9 10 11 12 1 1(–3) ? D G G S S 2 2 ? ? D D A A N N R R ? P C C 1(2) D G S 2 U D A N R P C 1/2 1/2 1 1 1 1 1 2 2 2 2 2 2 2 2 2 1 1 2 2 2 2 2 2 2 2 2 2 1 2 2 2 2 1 2 1 2 2 1 2 2 1 2 2 1 1 1 1 1 1 1 1 1 1 2 2 ? ? D D D D ? ? ? D ? D ? ? ? ? ? ? ? ? ? ? ? ? D ? ? D ? ? D ? ? ? ? ? D D D D D D D D ? ? ? ? ? ? ? ? ? ? D ? G/E GE GE G G G G E E E E E E E E E E E E E E E E E E E E E E E E E E E E E E G G7/E9 E E E E E E E E E E G/E E E E E E GE S S S R S S S R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R S S R R R R R R R R R R R R R R R S‡ S 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 1 2 2 1 1 1 1 1 2 2 2 2 2 2 2 2 1 2 2 2 2 2 2 2 2 2 2 230 U U U U U U E22/U29 U E E E E E ? ? E E E ? E E E ? ? E ? E E E U E E U E U U U U U U9/E7 E E7/U29 E E7/U29 U U U U U U U U U U U U30 D D D D D D D D S S/D D S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S D D A A A A A A E E A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A N N N N N N N N B N N N N N N N N N N N N N N N N N N N N N N N N N N N B B N N N N N N N B N N N N N N N N N N R R R R R R R R – F F F F F F F F F F F F F F F F F F F F F R F F F R R R R/C R R R R R R R R R R R R R R R R F F?/R? ? P P P P ? P P – P P ? ? ? ? ? ? ? ? ? ? ? ? ? P ? ? ? ? ? A30 ? ? ? ? ? A A† ? ? P ? P P ? ? ? ? ? ? ? ? ? ? ? ? C C C C C C P P – D D D D D D D D D D D D D D D D D D D D D C/D D D D D D C P P P P P P P P C C C C C C C C C D C? © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 Cladopus austrosinensis18 Cladopus fukienensis (syn. C. austro-osumiensis)8,16,19,23 Cladopus doianus (syn. C. japonicus, C. chinensis, C. austrosatumensis)1,3,16 Cladopus pierrei7,29 Cladopus javanicus12,19 Cladopus nymanii1,7,19 Cladopus queenslandicus16 Cladopus taiensis7,22,23 Cladopus fallax6,7,22 Paracladopus chiangmaiensis22,23,29 Paracladopus chanthaburiensis25 Hydrodiscus koyamae28,29 Hanseniella heterophylla7,20,21 Thawatchaia trilobata20,21 Hydrobryum bifoliatum7,20 Hydrobryum kaengsophense20 Hydrobryum sp. TPK1631 Hydrobryum sp. TPK2231 Hydrobryum tardhuangense20 Hydrobryum khaoyaiense20 Hydrobryum micrantherum7,20 Hydrobryum phetchabunense26 Hydrobryum sp. LK313–31730 Hydrobryum loeicum20 Hydrobryum vientianense15,29 Hydrobryum koribanum11 Hydrobryum puncticulatum11 Hydrobryum japonicum4,7,13,20 Hydrobryum floribundum5,11 Hydrobryum chiangmaiense20 Hydrobryum griffithii7,20 Hydrobryum austrolaoticum29 Hydrobryum verrucosum29 Hydrobryum ramosum7,29 Hydrobryum somranii20 Hydrobryum subcrustaceum29 Hydrobryum takakioides29 Hydrobryum taeniatum29 Hydrobryum subcylindricum29 Zeylanidium subulatum7,9,14 Griffithella hookeriana2,7,9,24,30 Farmeria metzgerioides2,7,9 Polypleurum munnarense7,9 Polypleurum stylosum7,9,23 Polypleurum schmidtianum7,22,29 Polypleurum elongatum7,23 Polypleurum wallichii7,22,23,29 Polypleurum longistylosum22 Polypleurum longicaule22 Polypleurum pluricostatum29 Polypleurum wongprasertii22 Polypleurum insulare26 Polypleurum sisaketense26 Polypleurum phuwuaense22 Polypleurum erectum22 Polypleurum longifolium22 Polypleurum prachinburiense26 Willisia selaginoides7,9 Willisia arekaliana10 1 492 S. KOI ET AL. APPENDIX 4 Continued Zeylanidium olivaceum7,9,14 Zeylanidium maheshwarii9,14 Zeylanidium lichenoides7,9,14,26 Zeylanidium sp. A. K. Pradeep 90001 & KI208 Zeylanidium sp. KI216 Hydrobryopsis sessilis7,9,27 1 2 3 4 5 6 7 8 9 10 11 12 2 2 2 2 D D D ? E E E GE R R R R 2 2 2 2 U U U U S S S S A A A E? N N N N F F R R P P A ? D D C C 2 2 ? D GE G R S 2 2 U U S S E? A N N R R ? A?17 C C APPENDIX REFERENCES Cusset C. 1973. Podostemaceae. Flore du Cambodge du Laos et du Viêt-nam 14: 65–74. Hiyama Y, Tsukamoto I, Imaichi R, Kato M. 2002. Developmental anatomy and branching of roots of four Zeylanidium species (Podostemaceae), with implications for evolution of foliose roots. Annals of Botany 90: 735–744. Imamura S. 1928. Über Cladopus japonicus n. sp., eine Podostemonaceen in Japan. Botanical Magazine (Tokyo) 42: 379–387. Imamura S. 1929. Über Hydrobryum japonicum Imamura, eine neue Podostemonacee in Japan. Botanical Magazine (Tokyo) 43: 332–339. Johnson LA, Soltis DE. 1994. matK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Systematic Botany 19: 143–156. Kadono Y, Usui N. 1995. Cladopus austro-osumiensis (Podostemaceae), a new rheophyte from Japan. Acta Phytotaxonomica et Geobotanica 46: 131–135. Kato M, Fukuoka N. 2002. Two new species of Diplobryum (Podostemaceae, Podostemoideae) from Laos. Acta Phytotaxonomica et Geobotanica 53: 115–120. Kato M, Hambali GG. 2001. Cladopus javanicus (Podostemaceae), a new species from Java. Acta Phytotaxonomica et Geobotanica 52: 97–102. Kato M, Koi S, Kita Y. 2004. A new foliose-rooted genus of Podostemaceae from Thailand with a note on root evolution. Acta Phytotaxonomica et Geobotanica 55: 65–73. Koi S, Kato M. 2003. Comparative developmental anatomy of the root in three species of Cladopus (Podostemaceae). Annals of Botany 91: 927–937. Koidzumi G. 1935. Contributiones ad cognitionem florae Asiae orientalis. Acta Phytotaxonomica et Geobotanica 4: 15–29. Möller H. 1899. Cladopus nymani n. gen., n. sp., eine Podostemacée aus Java. Annales du Jardin Botanique de Buitenzorg 1: 115–132. Nakayama S, Minamitani T. 1999. A new species of Hydrobryum (Podostemaceae), H. koribanum from Japan. Journal of Japanese Botany 74: 307–316. Rutishauser R, Pfeifer E. 2002. Comparative morphology of Cladopus (including Torrenticola, Podostemaceae) from East Asia to north-eastern Australia. Australian Journal of Botany 50: 725–739. Sehgal A, Khurana JP, Sethi M, Ara H, Jain M. 2007. Organ identity of the thalloid plant body of Griffithella hookeriana and Polypleurum stylosum – Podostemoideae (Podostemaceae). Plant Systematics and Evolution 267: 93–104. Sehgal A, Sethi M, Mohan Ram HY. 2002. Origin, structure, and interpretation of the thallus in Hydrobryopsis sessilis (Podostemaceae). International Journal of Plant Sciences 163: 891–905. Sehgal A, Sethi M, Mohan Ram HY. 2009. Development of the floral shoot and pre-anthesis cleistogamy in Hydrobryopsis sessilis (Podostemaceae). Botanical Journal of the Linnean Society 159: 222–236. © 2012 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 169, 461–492 Downloaded from https://academic.oup.com/botlinnean/article/169/3/461/2416146 by guest on 06 June 2022 *Character states: 1, stamen (1, single; 2, two); 2, pollen (M, monad; D, dyad); 3, ovary/capsule (G, globose; E, ellipsoidal; GE, globular–ellipsoidal); 4, capsule (R, ribbed; S, smooth); 5, locule (1, one; 2, two); 6, capsule valve (E, equal; U, unequal); 7, bract (S, simple; D, digitate or lobed); 8, leaf (A, adaxi–abaxially dorsiventral; E, ensiform); 9, reproductive-shoot branching (N, non-branched; B, branched); 10, root (R, ribbon-like; F, foliose; C, cup-like); 11, root cap (A, absent; P, present); 12, shoot position (C, only at sinus of root branching; P, on lateral flank along length of root including sinus of root branching; D, dorsal surface in foliose root). References: 1Möller, 1899; 2Willis, 1902; 3Imamura, 1928; 4Imamura, 1929; 5Koidzumi, 1935; 6Cusset, 1973; 7Cusset, 1992; 8Kadono & Usui, 1995; 9 Mathew & Satheesh, 1997; 10Shivamurthy & Sadanand, 1997; 11Nakayama & Minamitani, 1999; 12Kato & Hambali, 2001; 13Ota et al., 2001; 14 Hiyama et al., 2002; 15Kato & Fukuoka, 2002; 16Rutishauser & Pfeifer, 2002; 17Sehgal, Sethi & Mohan Ram, 2002; 18Kato & Kita, 2003; 19Koi & Kato, 2003; 20Kato, 2004; 21Kato, Koi & Kita, 2004; 22Kato, 2006a; 23Koi et al., 2006; 24Sehgal et al., 2007; 25Koi et al., 2008; 26Kato & Koi, 2009; 27 Sehgal, Sethi & Mohan Ram, 2009; 28Koi & Kato, 2010a; 29Koi & Kato, in press; 30S. Koi, unpubl. data; 31P. Werukamkul et al., unpubl. data. †Observation on seedling; ‡One middle rib per capsule valve.

RELATED PAPERS

RELATED TOPICS

Log In

Molecular phylogenetic analysis of Podostemaceae: implications for taxonomy of major groups

Molecular phylogenetic analysis of Podostemaceae: implications for taxonomy of major groups

Related Papers

RELATED PAPERS

RELATED TOPICS