The molecular diversity of the 5s rRNA gene in Kengyilia alatavica (Drobov) J.L. Yang, Yen & Baum (Poaceae: Triticeae): potential genomic assignment of different rDNA units Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. I Bernard R. Baum and L. Grant Bailey Abstract: 5 s rRNA sequences from several accessions of Kengyilia alatavica, a member of a tribe that includes wheat and wheat relatives, have been amplified by the polymerase chain reaction, cloned, and sequenced. From an evaluation of the aligned sequences, five 5 s unit classes have been discerned. One class consists of short units, while the other four contain longer units. BLAST searches of the GenBankB database have allowed us to tentatively assign these to classes found in genomes of other species. For example, the short 5 s unit class and one long 5 s unit class were designated, respectively, "short PI" and "long PI" because of their match with the comparable sequenced 5 s rDNA accessions of Agropyron cristatum, a carrier of the P genome. Another unit class, is coined as "long Rl", because of its similarity to the units sequenced from Secale cereale and Secale vavilovii, carriers of the R genome. The third unit class was designated "long S 1" and is found also in Elytrigia spicata, a carrier of the S genome. Implications of these findings on the possible association of some unit classes with cytological haplome and on concerted evolution are discussed. Key words: 5 s RNA gene, genomes, concerted evolution, Triticeae. RCsumC : Les sCquences codant 1'ARNr 5 s chez plusieurs accessions du Kengyilia alatavica, un membre de la tribu qui comprend le blC et les espkces apparentkes, ont CtC amplifiCes par PCR, clonCes et sCquencCes. Suite B un alignement de ces sCquences, cinq classes ont pu Stre distingukes. Une classe consiste de courtes unitCs tandis que les quatre autres posskdent des unitCs plus longues. Des recherches BLAST de la base de donnCes GenBankB ont permis d'assigner provisoirement ces sCquences B des classes qui sont prCsentes dans les gCnomes de d'autres espkces. Par exemple, l'unitC 5 s de petite taille et une unit6 5 s de plus grande taille ont CtC designees respectivement ccP1 courten et ccP1 longuen en raison de leur ressemblance avec les ADNr 5 s sCquencCs chez des accessions de 1'Agropyron cristatum, une espkce portant le genome P.Une autre classe a CtC appelCe ccR1 langue,, en raison de sa similitude avec les unites sCquencCes chez le Secale cereale et le Secale vavilovii, deux espkces portant le genome R. La troisikme classe a CtC appelCe ccS 1 langue,, puisqu'elle se trouve Cgalement chez 1'Elytrigia spicata, une espkce portant le genome S. Les implications de ces conclusions sur une possible association des certaines classes d'unitCs avec l'haplome cytologique et sur 1'Cvolution concertCe sont discutCes. Mots elks : gkne codant 1'ARNr 5S, gCnomes, Cvolution concertCe, Triticeae. [Traduit par la Redaction] Introduction In many plants the genes coding for the 5 s rRNA are assembled into clusters of tandem repeats found on different chromosomes. Each of the thousands of copies consists of a transcribed region 120 base pairs (bp) long and a nontranscribed spacer (NTS) of different sizes in different species and at different loci within a species (Appels et al. 1980; Ananiev 1990; Baum and Johnson 1994, 1996). The number of copies of the 5 s rDNA gene repeat was estimated to be in the 7000- Corresponding Editor: G. Fedak. Received July 15, 1996. Accepted November 26, 1996. ' L.G. Bailey. Eastern Cereal and Oilseed B.R. ~ a u m and Research Centre, Agriculture and Agri-Food Canada, Central Experimental Farm, Ottawa, ON KIA OC6, Canada. Author to whom all correspondence should be addressed (e-mail: baumbr@em.agr.ca). Genome, 40: 215-228 (1997) 8000 range for wheat (Triticum aestivum L. cv. Chinese Spring) by Roder et al. (1992). As part of our effort to analyse the diversity of the 5 s DNA units in order to detect the different orthologous members of the 5 s multigene family and thus to determine the usefulness of the NTS in taxonomic and phylogenetic analyses in Hordeum (Baum and Johnson 1994, 1996) and the Triticeae, we have undertaken an in-depth analysis of the genus Kengyilia. The analyses of the 5 s rDNA units in Kengyilia are reported here for the first time. The genus Kengyilia is a hexaploid (2n = 42) member of the tribe Triticeae, and is related to wheat, barley, and other cereals and their wild relatives. At the cytological level, the haplomes of Kengyilia are S, Y, and P (Yen and Yang 1990). The S haplome is thought to originate from Pseudoroegneria, a genus conventionally known as Elytrigia, composed of a number of diploid species; the Y haplome is from a yet unknown diploid progenitor (Dewey 1980a, 1980b); and the P haplome is from the genus Agropyron, possibly Agropyron pectiniforme Roem. & Schult. Since several genomes in Kengyilia 0 1 997 NRC Canada 216 Genome, Vol. 40, 1997 Fig. 1. Alignment of a representative of the "short P1" unit class of Kengyilia alatavica (22L05), 3 14 bp long, with the sequences of Agropyron cristatum (ACSSDNAB, accession 211476) and Triticum monococcum (TM5S23, accession X33696) identified by BLAST to be most likely similar. ( a )Alignment view. The varying shades indicate linked identities based on comparisons in the three sequences; blocks involving fewzr sequence linked identities are progressively lighter, the darkest being black with symbols in bold white, the next lighter also black but with symbols not in bold, etc. Arrow 1 indicates the start (5' end) of the transcribed region; arrow 2 indicates the start of the identity stretch between 22L05 and AC5SDNAB only; arrow 3 indicates the identity stretch between the three sequences in the NTS, up to arrow 1. ( b ) Schematic view of the same alignment. Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. Table 1. Clones sequenced in the Kengyilia alatavica study listed by collection accession number. 5 s unit class Accession Origin Clone Size of repeat (bp) ENIBL-G~~B~~~@DDBJ accession No. Kyrgyzstan China Long R 1 PI53 1709 PI499588 Y2869 Kyrgyzstan China China Long PI PI53 1709 Kyrgyzstan PI499588 PI53 1709 PI499588 PI53 1709 China Kyrgyzstan China Kyrgyzstan Long P2 Long S 1 China have been donated from other species, the presence of various kinds of 5 s rDNA repeat units is expected. Indeed it may be possible that the kind of 5 s repeat may identify or tag the different genomes. Our studies focused on Kengyilia alatavica (Drobov) J.L. Yang, Yen et Baum and includes Kengyilia longiglumis (Keng et S.L. Chen) J.L. Yang, Yen et Baum (C. Yen, J.L. Yang, and B.R. Baum, in preparation), a species found in the Xinjiang Province, West China and the adjacent country Kyrgyzstan. It grows on the steppes at high altitudes and is cold resistant as well as drought and salt tolerant. Along with other Kengyilia species, its genetic potential for improving and for increasing disease resistance of wheat and other cereals in the Triticeae has not yet been investigated. Materials and methods Three accessions of K. alatavica (PI53 1709, collected 8 September 1973: Kyrgyzstan, Dzeto-Oghuz river gorge, Terskei-Alatau mountains, southwest of Prshevalsk, Khirgizia; PI499588, collected: China, Xinjiang, South Mountain, about 70 km southwest of Urumqi, elevation, 2000 m; and Y2869, collected in 1992: China, Xinjiang, Wu-quia county to Tuo-yun, were used. Plants were grown in a greenhouse from seed received from the United States Department of Agriculture, Agricultural Research Service (see National Genetic Resources Program at URL: www.ars-grin.gov). The following Hordeum accessions were also used: Hordeum jubatum (CHC349 1 , CHC3489) and Hordeum procerum (CHC1324) from the Plant Gene Resources of Canada; and Hordeum secalinum (H290, H296, H1711), and Hordeum roshevitzii (H7039, H7046) from the seed collection of the Department of Plant Breeding Research, Svalov, Sweden. 01 997 NRC Canada Baum and Bailey (a) 22L05 AC 5 S DNAB TM5S23 Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. 22L05 A C 5 S DNAB TM5S23 ............................. cgcggtatagagggaggggtggaacccgt ............................. .................... 70 239 140 22L05 A C 5 S DNAB TM5S23 22L05 AC 5 S DNAB TM5S23 01997 NRC Canada 218 Genome, Vol. 40, 1997 Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. Fig. 2. Alignment of all the 14 long 5 s units in Kengyilia alatavica. (a) Alignment view. The varying shades indicate varying linked identities from strongly linked to weakly linked as in Fig. 1. Arrows numbered 1: the AAATACGTGG stretch featured in the S 1 unit class but lacking in the others (gaps); arrows numbered 2: gaps in the S l unit class and stretches of CGTAAGTAGTGTAGGGCAT (with some minor transitional changes) present in the other unit classes; arrows numbered 3: gaps in the S l unit class different from the comparable region in the other unit classes, except for P2 with a small gap delineated by the arrows numbered 4; note that P1 and P2 lack nucleotides at the position between the two arrows numbered 5. (b) Schematic view of a. Seeds were sown and plants grown in a greenhouse. DNA was isolated and amplified by PCR as in Baum and Johnson (1994, 1996). The PCR products were run in agarose gel and the resulting bands cut out and purified before being digested with BamHI. The purified fragments were then ligated into pUC19 (Yanisch-Perronet al. 1985) and ligants were transformed into TB I line (New England Biolabs) cells of Escherichia coli. Sequencing reactions were carried out in the forward and reverse directions using the T7~equencingTM kit ~ ~ ~ a1 ~mCi (1 Ci = (Pharmacia Biotech) with [ a 3 5 ~ ] d (Dupont; 37 GBq)). Sequencing gels were run manually. The autoradiographs 01997 NRC Canada Baum and Bailey Fig. 2 (continued). Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. (a) (cofl~ifluetl}. were read manually as well, in both the forward and reverse lanes. Thirty clones were isolated and sequenced in this manner (Table I). The alignments of the 5 s DNA sequences were performed using CLUSTAL v (Higgins et al. 1992) and MACAW (Schuler et al. 1991), the latter program aiding in refining the crude alignments made by CLUSTAL. TOinfer unit classes, i.e., sequence groups, alignments were visually inspected. Apparently similar clones were separately realigned until it became obvious that they were similar. This was carried out by trial and error until the sequences were found to be optimally subdivided into "homologous" groups called unit classes. Exemplars of each identified unit class were matched b computer searches for homology with the sequences in Genbank using the J NCBI (National Center for Biotechnology Information) BLAST network service and programs (Altschul et al. 1990). Results We will henceforth use the terminology of Baum and Johnson (1996) in which we described the two classes "short" and "long" (Appels and Baum 1992). As in Baum and Johnson (1996), we recognize, in addition, subdivisions (groups) within each class and as before we call them "5s unit classes." All the sequenced clones are listed in Table 1. 01997 NRC Canada Genome, Vol. 40, 1997 Fig. 2 (continued). Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. (a) (cotlciudctl). RI. %%LO2 F. ! 2 3 I,03 Ri 32L03 iil 32l'Il"O 171. 2 21'06; P 1. 2 :3 T.,O i 1'1 :.':3L(')4 P2 22LG9 I):.! 23MOr3 Si 23M0.1. S 1. 2 3M 0 4 S1 23S02 S1 .:32T,06 SZ 32SCi2 The "short" units We observed that 16 of the 30 clones are between 307 and 3 15 bp long, with most being 3 13 or 3 14 bp and demonstrating little sequence variation. Two clones, 22L03 and 22L04, have the same 7-bp deletion of ACGCACG (see Fig. la, position 36 to position 42 in clone 22L05) near the 5' end of the NTS. Members of this 5 s unit class were aligned with 5 s rDNA units from several Hordeum species, including Hordeum bulbosum L., Hordeum spontaneum C. Koch, and Hordeum vulgare L. (Baum and Johnson 1994, 1996), as well as repre- sentatives of the H genome Hordeum species (in the sense of von Bothmer et al. (1986, 1987)), such as Hordeum jubatum L., Hordeum procerum Nevski, Hordeum secalinum Schreb., and Hordeurn roshevitzii Bowden (B.R. Baum and D.A. Johnson, unpublished data). The BLAST search of the Gen~ankOcollection identified a 5 s rDNA sequence from Triticum nzonococcum (Gen~ankOaccession X66390) as having the smallest sum probability of similarity to K. alatavica, and a unit from Agropyron cristatum (Gen~ank"accession 2 1 1476) as having the highest score of nucleotide 01997 NRC Canada Baum and Bailey Fig. 2 (concluded). (b) Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. R1 22L02 similarities. The alignment of the two sequences with the K. alatavica unit 22L05 is shown in Fig. 1. There is almost complete identity among the three sequences (from arrow 3 to the 3' end), with this similarity extending even further (to arrow 2), when only K. alatavica and A. cristatum are compared. The units described here are classified as "short" and are most similar to a long sequence of A . cristatum. We failed to detect closer similarity to the "short" units described previously in Hordeum or to any other "short" unit among the Gen~ank@ accessions. To date, a "short" unit from A . cristatum has not been sequenced. On the basis of these results we suggest that the "short" units represent a new 5 s unit class, most similar to a long sequence from A. cristatum, which is the probable donor of the P haplome to Kengyilia. This class can tentatively be named the "short PI" unit class. The "long" units Fourteen of the 30 clones vary in length from 380 to 521 bp. Aside from clone 23L04, which, owing to a major deletion has been reduced to 380 bp, the smallest unit in this group is 422 bp long. In contrast to the short units above, the long units vary in size and nucleotide content, and so they can be divided into a number of unit classes. Four unit classes were distinguished among those "long" sequences, as shown in Fig. 2a. The first unit class, here designated "long Sl," almost entirely matches the sequence of Pseudoroegneria spicata 01997 NRC Canada 222 Genome, Vol. 40, 1997 Fig. 3. Alignment of Kengyilia alatavica clone 23MO1, a representative of the "long S 1" unit class, with ~ e n ~ a n accession k@ 2 1 1458 clone ES5SDNAA from Elytrigia spicata (Pseudoroegneria spicata), a carrier of the S haplome. The almost complete similarity is indicated by the strongest differential shading at most positions. See text. Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. 23M01 ESSSDNAA (Pursh) A. Love, which is 447 bp long and has been sequenced by Scoles et al. (1988). From among the sequences in the data base, the BLAST search found this to be the most probable accession (GenBankB 2 1 1458), as well as the one with the highest scores for nucleotide matches. The designation "long S1" reflects the similarity of the 5 s units, present in clones 23M01, 23M04, 32L06, and 32S02, with the known units sequenced in the diploid species P. spicata carrying the S haplome. An alignment of the 23M01 clone with P. spicata accession Zl1458 confirms this result (Fig. 3). The second unit class is designated "long P1" because of its very close similarity to the comparable 5 s unit in A. cristatum, (GenBankmaccession 2 1 1476) based on the BLAST search. The symbol P is used to denote the similarity with the P haplome in A. cristatum. An alignment including clone 22L06 is shown in Fig. 4. The other clones in this unit class are 23LO1 and 23L04 (Table 1; Fig. 2). This unit class is a few base pairs shorter than the comparable unit in A. cristatum. The difference in length is due to two deletions in the NTS, one of which is 3 bp and the other 8 bp (Fig. 4). Unit 23L04 belongs here (alignment shown in Fig. 2) owing to a large deletion that may have arisen as a result of the creation of a BamHI site. Since the isolation procedure depends on the presence of a unique BamHI site within the 5 s repeat, the presence of a second BamHI site would lead to the loss of DNA during cloning (Baum and Johnson 1996). The third unit class is a new one. This unit class is a true long one in the sense of Appels and Baum (1992), because of its nucleotide size length, which ranges from 478 to 482 bp in clones 22L02, 23L03, 32L03, and 32L10 (Table 1; Fig. 2a). Clone 32L10 is longer but carries a contiguous duplication in the coding area (Figs. 2a and 2b) and has been included here. The BLAST search revealed a close similarity, in terms of nucleotide matches, with Secale cereale (GenBankB accession 2 1 1440), as well as with Secale vavilovii (accession 2 1 1446), and slightly less so with A . cristatum (Z11476). Figure 5 demonstrates these similarities. We have tentatively designated this unit class as "long R1" to reflect the similarity with the R haplome present in the diploid Secale. The fourth unit class, based on the two clones, 22L09 (422 bp) and 23M03 (428 bp) (Table 1; Fig. 2a), might be a new unit class. The BLAST search pointed unequivocally to A. cristatum, GenBankm accession 2 1 1476, which is the carrier of the P haplome. In terms of number of nucleotide matches, however, the BLAST search pointed to H. vulgare GenBankm accession U07388, i.e., clone HVUL028 of Baum and Johnson (1994) later included in "long group 5" by Baum and Johnson (1996). Although 23M03 is similar to HVUL028 in terms of length, the alignment (Fig. 6a) demonstrates a higher sequence similarity with 2 1 1476. Thus, the fourth unit class is here designated "long P2" to reflect the kinship with 0 1997 NRC Canada 223 Baum and Bailey Fig. 4. Alignment of Kengyilia alatavica clone 22L06, a representative of the "long PI" unit class, with ~ e n ~ a n accession k@ 21 1476 clone ACSSDNAB from Agropyron cristatum, a carrier of the P haplome. See text. 22L06 AC 5 S DNAB 22L06 AC 5 SDNAB Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. 22L06 AC5SDNAB 22L06 AC 5 S DNAB a 229 240 22L06 AC 5 S DNAB 22L06 AC 5 S DNAB 22L06 AC 5 S DNAB the P haplome. ACSSDNAB and 23M03 differ only in length and in the resulting comparative deletions, i.e., the gaps as shown in Fig. 6b. A summary of the similarities and differences between the four long unit classes can be visualized in the schematic view of the MACAW alignment (Fig. 2b). The first striking feature is that the S 1 unit class differs from the rest by the lack of a gap at the position between the two arrows labelled 1 (Figs. 2a and 2b), and by the presence of two gaps indicated by the arrows numbered 2 and 3. The unit class P2 differs from the rest by the gaps indicated by the arrows labelled 4 (Fig. 2a). P1 and P2 lack the stretch of GTGG and a few more nucleotides at the position between the two arrows labelled 5 (Fig. 2a). Discussion In addition to having identified several orthologous groups of the 5 s rDNA units, i.e., 5 s unit classes, the most important finding of this investigation is that the 5 s DNA gene, especially the NTS, may serve as a potential tool for detecting genomic relationships in the Triticeae. We were able to identify five different unit classes from among the 5 s DNA units in K. alatavica. One unit class, represented by 16 clones, here designated as "short PI," is different from any of the short units found in Hordeum. The short units of the species with the I haplome, as designated by von Bothmer et al. (1986, 1987), including H. vulgare, H. spontaneum, and H. bulbosum, were found by Baum and Johnson (1994, 1996) to contain varying numbers of TAG repeats as well as other characteristics. The typical short unit class in these three Hordeum species is 301 bp long, but because of the TAG repeats can be up to 508 bp long (Baum and Johnson 1994) or longer (Kanazin et al. 1993). Baum and Johnson (1994, 1996) referred to it as the "short group 1" unit class. The short unit class in K. alatavica, designated "short Pl," is 3 12-3 15 bp long with two exceptions, 22L03 and 22L04 (Table 1 and discussed above), which are 307 and 308 bp long, respectively. This short unit class did not reveal any matches in alignment with comparable units either in some annual Hordeum species, carriers of the I haplome, or in perennial Hordeum species (B.R. Baum and D.A. Johnson, in preparation), carriers of the H haplome. Thus the "short P1" unit class is a new one, different from the short group 1 in barley, and its units have no TAG repeats. The closest match of these short 5 s units was with the long unit (the only 5 s unit " ) A. cristatum, a species carrying the available in ~ e n ~ a n k of 01997 NRC Canada Genome, Vol. 40, 1997 224 Fig. 5. Alignment of Kengyilia alatavica clone 22L02, a representative of the "long R1" unit class, with ~ e n ~ a n kaccession " 211446 clone SVSSDNAA of Secale vavilovii, and with 21 1476 clone ACSSDNAB of Agropyron cristatum. Note the overall high degree of similarity of the three sequences and their differences. Arrow 1: start (5'end) of the transcribed region. The varying shades indicate varying linked identities from strongly linked to weakly linked as in Fig. 1. 22L02 Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. SV5SDNAA AC5 SDNAB 22L02 SV5SDNAA AC5S DNAB 22L02 SV5S DNAA AC 5SDNAB 22L02 SV5SDNAA AC 5S DNAB P haplome (Love 1984), not with the I or the H haplomes of Hordeum (von Bothmer et al. 1986, 1987). A comprehensive sequencing study in A. cristatum is needed to ascertain whether similar short 5S units are present in this species or in other species of this genus. Among the long 5S unit classes in Kengyilia, types similar to those of the P and S haplomes in other genera are clearly identified. There are a large number of similarities in the respective alignments (Figs. 3 and 4). The "long P1" and "long Sl" unit classes are intermediate in length, i.e., 445472 bp. The "long P2" unit class is shorter still, 422428 bp, but is more similar to A. cristatum 2 1 1476 than to its most likely counterpart in barley, the "long group 5" (Baum and Johnson 1996). This can be clearly seen in the alignment shown in Fig. 6a. Therefore, it is uncertain whether longer unit classes in that category exist in Kengyilia. Such long units have not yet been found either among the clones sampled or by exhaustive BLAST searches in the ~ e n ~ a n database. k@ The alignment in Fig. 6a shows another point with respect to transcription factors in the initiation complex for RNA polymerase 111. The spacer region is thought to bind TFIIIB, but those respective sequences implicated in this are not highly conserved (Sastri et al. 1992). This is apparent in Fig. 6a in the sequences upstream to the 3' end of the transcribed region and prior to the 01997 NRC Canada Baum and Bailey 225 Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. Fig. 6. ( a ) Alignment of Kengyilia alatavica clone 23M03, a representative of the "long P2" unit class, with clones ACSSDNAB (Agropyron k@ 21 1476) and HVUL028, a representative of the long group 5 unit class from Hordeum vulgare. The varying cristatum, ~ e n ~ a n accession shades indicate varying linked identities from strongly linked to weakly linked as in Fig. 1. (b) Alignment of K. alatavica clone 23M03 with clone ACSSDNAB. 23M03 AC5 S D N A B HVUL028 2 3M0 3 AC5 SDNAB HVUL02 8 23M03 AC5 SDNAB HVUL02 8 23M03 AC5 SDNAB HVUL02 8 ------------- 249 258 2 70 ------------- aaattcttgtgtt -------------------------------------------- _ _ _ _ - ^ - - I - - - - - - - - cggtcgtaatggtagtaagaatgtgcaatcgtctttgttgtgga -gaaaaaatatggcaatgg - - - - - - - - - - - - - - - - - - - - - - - 265 318 288 23M03 AC5 SDNAB HVUL028 381 436 406 2 3M0 3 AC5 S D N A B HVUL028 428 483 454 long deletion, where HVUL028 does not align well with the other two sequences. The long R1 unit class is a true long one in the sense of Appels and Baum (1992), i.e., 478-521 bp. This unit class was found to be closest to the sequences of S. cereale and S. vavilovii, carriers of the R haplome (Love 1984). The alignment (Fig. 5) demonstrates the closeness detected by the BLAST search between accessions 2 1 1476 and 2 1 1446. The duplication in the coding area of clone 32L10 is similar to the one reported for T. aestivum cv. Chinese Spring (Appels et al. 1992). It is still too early to speculate on the cytological impli- cations, if any, of the similarity with the R genome bearing species. The current theory is that the two forms of the 5 s RNA genes, i.e., the long and the short (Appels and Baum 1992), may predate the diversification of the Triticeae (Kota and Dvofik 1986; Scoles et al. 1988; Lagudah et al. 1989; Dvofik et al. 1989; Reddy and Appels 1989). Whether the 5 s DNA gene units underwent changes before or after genome differentiation, or both, is unknown. The findings of this investigation, however, certainly point to the possibility that some 5 s DNA unit classes took part in genomic differentiation. This is 01997 NRC Canada Genome, Vol. 40, 1997 Fig. 6 (concluded). (b) 23M03 AC 5 S DNAB 2 3M0 3 AC 5 S DNAB 23M03 120 120 C 172 180 a------- Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. AC 5 S DNAB 2 3MO 3 231 240 AC5SDNAB .......................... cggtcgtaatggtagtaagaatgtgc 2 65 300 2 3M0 3 AC5 S DNAB based on the assumption that the "long PI" and "long S1" 5 s unit classes, now considered paralogous, evolved from a common ancestor during genomic differentiation and retained their identity in the amphiploid Kengyilia. The pieces of the puzzle will certainly come together with further progress in sequencing 5 s RNA gene from the different Triticeae species and determining orthologous units. The utility of the entire 5 s RNA gene sequences, especially the NTS, for phylogenetic purposes, was initially demonstrated for the Triticeae by Scoles et al. (1988), Appels and Baum (1992), Baum and Appels (1992), and Reddy and Appels (1989). Baum and Johnson (1994, 1996) have unravelled a number of orthologous groups in the 5 s multigene family in Hordeum and indicated the necessity to subclone PCR products prior to sequencing in order to determine orthology in general. The present paper is an initial effort toward finding orthologous sequences in Kengyilia and Roegneria. Roegneria is a large genus in the Triticeae (Baum et al. 1991) from which Kengyilia has recently been distinguished (Baum et al. 1995). In addition to finding orthologous sequences, required for phylogenetic analysis, it is apparent that some of these orthologous groups may be indicators of haplomes, or an integral part of them. They may also be useful for finding the evolutionary relationships among the haplomes in the Triticeae. The 5 s RNA, i.e., the transcribed region, is believed to have limited use for phylogeny estimation (Halanych 1991; Steele et al. 1991). A recent analysis of 152 5 s units of the Triticeae data base showed that in many cases nucleotide diversity among the transcribed regions (the genes) is as high as or higher than that in the spacers (the NTS) (Kellog and Appels 1995). This analysis was most likely based on paralogous 5 s units. Sequence variation within each 5 s unit class is very low to nil (Baum and Johnson 1994, 1996; Figs. 1-6; published, as well as unpublished, sequences). The Triticeae data base is still too small and not yet suitable for making general inferences about the 5 s RNA gene. Much work still lies ahead in sequencing larger samples, i.e., a number of clones from within individuals for the different species in the Triticeae. Our findings have implications for understanding the role of concerted evolution (Zimmer et al. 1980; Dover 1982; Hillis and Dixon 1991 for a review) in the 5 s RNA gene. Concerted evolution is the non-independent evolution of repetitive DNA sequences resulting in a sequence similarity of repeating units, such as 5 s DNA units, that is greater within than among species. A number of poorly understood mechanisms, collectively known as "molecular drive," are responsible for the origin of tandem arrays of the repeat units (Dover et al. 1982). 01997 NRC Canada Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. Baum and Bailey Among these mechanisms, unequal crossing over and gene conversion (see Hillis 1994) have received the most attention. If the 5 s DNA units had undergone a high rate of concerted evolution, then the paralogous sequences would all be similar. Earlier findings pointed to two or more different types of paralogous sequences in the 5 s RNA gene in the Triticeae (Appels and Baum 1992; Baum and Appels 1992). Our results, and previous findings (Baum and Johnson 1994, 1996), have made an attempt to unravel many more orthologous sequences from among the different types of paralogues. If, as it appears from observations in K. alatavica, some of the 5 s unit classes either form integral parts of haplomes or remain conserved and identifiable within haplomes originating from distant species, then concerted evolution in the 5 s gene plays only a partial role as an evolutionary force. In K. alatavica, interaction between the ancestral S and P genomes and their respective S 1 and P I unit classes has had a minimal effect on the 5 s RNA gene, including the NTS. If concerted evolution, as a force in evolution, is at work, then it may have influenced the course of evolution of 5 s unit classes not assignable to haplomes, i.e., unique to K. alatavica alone or to K. alatavica and related species in this genus. In other words, some orthologous sequences remained preserved as much as the haplomes, while others remained preserved only in a smaller group within a genome. Sequencing of the 5 s rDNA clones, currently in progress, might support this possible scenario. Acknowledgements We are grateful to D.A. Johnson, University of Ottawa, and R. Appels, Commonwealth Scientific and Industrial Research Organization, Canberra, Australia, for their insightful comments on an earlier draft of the manuscript. References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-4 10. Ananiev, E.V. 1990. Nuclear genome structure and organization. In Biotechnology in agriculture. Vol. 5. Edited by P.R. Shewry. pp. 133-150. Appels, R., and Baum, B.R. 1992. Evolution of the NOR and 5 s DNA loci in the Triticeae. In Plant molecular systematics. Edited by J.J. Doyle and P.S. Soltis. Chapman and Hall, New York. pp. 92-1 16. Appels, R., Gerlach, W.L., Dennis, E.S., Swift, H., and Peacock, W.I. 1980. Molecular and chromosomal organization of DNA sequences coding for ribosomal RNAs in cereals. Chromosoma, 78: 293-3 11. Appels, R., Baum, B.R., and Clarke, B.C. 1992. The 5 s DNA units of bread wheat (Triticum aestivum). Plant Syst. Evol. 183: 183-194. Baum, B.R., and Appels, R. 1992. Evolutionary change at the 5 s DNA loci of species in the Triticeae. Plant Syst. Evol. 183: 195-208. Baum, B.R., and Johnson, D.A. 1994. The molecular diversity of the 5 s rRNA gene in barley (Hordeum vulgare). Genome, 37: 992-998. Baum, B.R., and Johnson, D.A. 1996. The 5 s rRNA gene units in ancestral two-rowed barley (Hordeum spontaneum C. Koch) and bulbous barley (H. bulbosum L.): sequence analysis and phylogenetic relationships with the 5 s rDNA units of cultivated barley (H. vulgare L.). Genome, 39: 140-149. Baum, B.R. Yang, J.L., and Yen, C. 1991. Roegneria: its generic limits and justification for its recognition. Can. J. Bot. 69: 282-294. Baum, B.R., Yang, J.L., and Yen, C. 1995. Taxonomic separation of Kengyilia (Poaceae: Triticeae) in relation to nearest related Roegneria, Elymus, and Agropyron, based on some morphological characters. Plant Syst. Evol. 194: 123-1 32. Dewey, D.R. 1980a. Cytogenetics of Agropyron ugamicum and six of its interspecific hybrids. Bot. Gaz. 141: 305-3 12. Dewey, D.R. 1980b. Cytogenetics of Agropyron drobovii and five of its interspecific hybrids. Bot. Gaz. 141: 469-478. Dover, G.A. 1982. Molecular drive: a cohesive mode of species evolution. Nature (London), 299: 111-1 16. Dover, G.A, Brown, S., Coen, E., Dallas, J., Strachan, T., and Trick, M. 1982. The dynamics of genome evolution and species differentiation. In Genome evolution. Edited by G.A. Dover and R.B. Flavell. Academic Press, San Diego. Dvofhk, J., Zhang, H.-B., Kota, R.S., and Lassner, M. 1989. Organization and evolution of the 5 s ribosomal RNA gene family in wheat and related species. Genome, 32: 1003-10 1 6. Halanych, K.M. 1991. %S ribosomal RNA sequences inappropriate for phylogenetic reconstruction. Mol. Biol. Evol. 8: 249-253. Higgins, D.G., Bleasby, A.J., and Fuchs, R. 1992. CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8: 189-191. Hillis, D.M. 1994. Homology in molecular biology. In Homology. The hierarchical basis of comparative biology. Edited by B.K. Hall. Academic Press, San Diego. pp. 339-368. Hillis, D.M., and Dixon, M.T. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66: 41 1-453. Kanazin, V., Ananiev, E., and Blake, T. 1993. The genetics of 5 s rRNA encoding multigene families in barley. Genome, 36: 1023-1 028. Kellog, E., and Appels, R. 1995. Intraspecific and interspecific variation in 5 s RNA genes are decoupled in diploid wheat relatives. Genetics, 140: 325-343. Kota, R.S., and DvoiBk, J. 1986. Mapping of a chromosome pairing gene and 5 s rRNA genes in Triticum aestivum L. by a spontaneous deletion in chromosome arm 5Bp. Can. J. Genet. Cytol. 28: 266-27 1. Lagudah, E.S., Clarke, B.C., and Appels, R. 1989. Phylogenetic relationships of Triticum tauschii, the D-genome donor to hexaploid wheat. 4. Variation in chromosomal location of 5SDNA. Gen?me, 32: 1017-1 025. Love, A. 1984. Conspectus of the Triticeae. Feddes Repert. 95: 425-52 1. Reddy, P.R., and Appels, R. 1989. A second locus for the 5 s multigene family in Secale L.: sequence divergence in two lineages of the family. Genome, 32: 456-467. Roder, M.S., Sorrells, M.E., and Tanksley, S. 1992. 5 s ribosomal gene clusters in wheat: pulsed field gel electrophoresis reveals a high degree of polymorphism. Mol. Gen. Genet. 232: 215220. Sastri, D.C., Hilu, K., Appels, R., Lagudah, E.E., Playford, J., and Baum, B.R. 1992. An overview of evolution in plant 5 s DNA. Plant Syst. Evol. 183: 169-1 81. Schuler, G.D., Altschul, S.F., and Lipman, D.J. 1991. A workbench for multiple alignment construction analysis. Proteins Struct. Funct. Genet. 9: 180-190. Scoles, G.J., Gill, B.S., Xin, Z.Y., Clarke, B.C., McIntyre, C.L., Chapman, C., and Appels, R. 1988. Frequent duplication and deletion events in the 5 s RNA genes and the associated spacer regions of the Triticeae. Plant Syst. Evol. 160: 105-122. Steele, K.P., Holsinger, K.E., Jansen, R.K., and Taylor, D.W. 1991. Assessing the reliability of 5 s rRNA sequence data for phylogenetic analysis in green plants. Mol. Biol. Evol. 8: 240248. 01997 NRC Canada 228 Yen, C., and Yang, J.L. 1990. Kengyilia gobicola, a new taxon from west China. Can. J. Bot. 68: 1894-1897. Zimmer, E.A., Martin, S.L., Beverly, S.M., Kan, Y.W., and Wilson, A.C. 1980. Rapid duplication and loss of genes coding for a chains of hemoglobin. Proc. Natl. Acad. Sci. U.S.A. 77: 2158-2162. Genome Downloaded from www.nrcresearchpress.com by 192.64.11.124 on 06/04/13 For personal use only. von Bothmer, R., Flink, J., and Landstrom, T. 1986. Meiosis in interspecific Hordeum hybrids. I. Diploid combinations. Can. J. Genet. Cytol. 28: 525-535. von Bothmer, R., Flink, J., and Landstrom, T. 1987. Meiosis in interspecific Hordeum hybrids. 11. Triploid combinations. Evol. Trends Plants, 1: 41-50. Yanisch-Perron, C., Vieira, J., and Messing, J. 1985. Improved M13 phage cloning vectors and host strains; nucleotide sequence of M13mp18 and pUC19 vectors. Gene (Amst.), 33: 103-1 19. Genome, Vol, 40, 1997 View publication stats 01997 NRC Canada