This article was downloaded by: [Max Perutz Library] On: 20 May 2015, At: 05:21 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK Israel Journal of Plant Sciences Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tips20 Cd accumulation potential as a marker for heavy metal tolerance in soybean a b c d d Peter Socha , Nirit Bernstein , Ĺubomír Rybanský , Patrik Mészáros , Terézia Gálusová , e f f f Nadine Spieß , Jana Libantová , Jana Moravčíková & Ildikó Matušíková a Faculty of Biotechnology and Food Sciences, Department of Biochemistry and Biotechnology, Slovak University of Agriculture, Nitra, Slovak Republic b Institute of Soil, Water and Environmental Sciences, Volcani Center, Bet-Dagan, Israel c Faculty of Natural Sciences, Department of Mathematics, Constantine the Philosopher University, Nitra, Slovak Republic d Faculty of Natural Sciences, Department of Botany and Genetics, Constantine the Philosopher University, Nitra, Slovak Republic Click for updates e AIT Austrian Institute of Technology GmbH, Tulln, Austria f Institute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Nitra, Slovak Republic Published online: 20 May 2015. To cite this article: Peter Socha, Nirit Bernstein, Ĺubomír Rybanský, Patrik Mészáros, Terézia Gálusová, Nadine Spieß, Jana Libantová, Jana Moravčíková & Ildikó Matušíková (2015): Cd accumulation potential as a marker for heavy metal tolerance in soybean, Israel Journal of Plant Sciences, DOI: 10.1080/07929978.2015.1042307 To link to this article: http://dx.doi.org/10.1080/07929978.2015.1042307 PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions Israel Journal of Plant Sciences, 2015 http://dx.doi.org/10.1080/07929978.2015.1042307 Cd accumulation potential as a marker for heavy metal tolerance in soybean
Peter Sochaa*, Nirit Bernsteinb, Lubom
ır Rybansk
yc, Patrik M
esz
arosd, Ter
ezia G
alusov
ad, Nadine Spieße, Jana f Libantov
a , Jana Moravc
ıkov
af and Ildik
o Matus
ıkov
af* a Faculty of Biotechnology and Food Sciences, Department of Biochemistry and Biotechnology, Slovak University of Agriculture, Nitra, Slovak Republic; bInstitute of Soil, Water and Environmental Sciences, Volcani Center, Bet-Dagan, Israel; cFaculty of Natural Sciences, Department of Mathematics, Constantine the Philosopher University, Nitra, Slovak Republic; dFaculty of Natural Sciences, Department of Botany and Genetics, Constantine the Philosopher University, Nitra, Slovak Republic; eAIT Austrian Institute of Technology GmbH, Tulln, Austria; fInstitute of Plant Genetics and Biotechnology, Slovak Academy of Sciences, Nitra, Slovak Republic Downloaded by [Max Perutz Library] at 05:22 20 May 2015 (Received 15 October 2014; accepted 1 January 2015) Plants have a potential for the uptake and accumulation of essential and non-essential trace elements. The ability to take up and tolerate metals varies between and within species as well as between metals. For most metals, the mechanisms involved in plant tolerance, uptake and accumulation are still not fully known and it is not known to what extent the plant response is metal-specific rather than a general stress response. In the present study, the growth response of soybean to Cd, As, Al and NaCl was compared and contrasted to simple sequence repeat (SSR) marker analysis results for Cda1, a dominant gene located in a major quantitative trait locus that regulates Cd accumulation in soybean, to evaluate the hypothesis that general effect patterns are induced by the individual metals. Principal component analysis revealed that the root growth response was most diverse for Al exposure and decreased in the order of Al > As > Cd > NaCl. NaCl did not exert a differentiating effect, indicating response mechanisms similar, at least partially, to metal exposure. The applied stressors yielded a distinguishable pattern of root responses, indicating the potential of such screens to identify agents acting similarly or differently. The SSR marker analysis also facilitated characterization of the Cd accumulation potential of the 22 soybean cultivars studied, and thereby identification of cultivars with potential health risk under cultivation in Cd-contaminated soils. Keywords: aluminum; arsenic; cadmium; genetic markers; soybean; tolerance Introduction There is a growing public concern over heavy metal (HM) contamination in the environment. Low concentrations of HMs are often present naturally in soils, but human activities such as mining, agriculture, sewage processing and the metal industry increase their level in the environment, resulting in concentrations that are toxic to animals and plants (Su et al. 2014). Consequently, HMs are considered as significant environmental pollutants and are the focus of increasing number of studies. Many of the HMs, such as Fe, Mn, Mo, Cu and Zn, are essential micronutrients and are required in small quantities for the normal growth and function of plants. However, they become toxic when present in excess. Other HMs, such as Cd, Cr, Hg and Pb, do not have any known biological function in the plant and their accumulation induces damage and toxicity (Peralta-Videa et al. 2009). Plants take up HMs from the soil solution and translocate them to the above-ground edible parts (Singh et al. 2012). HMs thereby enter the human food chain through plants, and the consumption of plant material containing high levels of MHs could be a food safety concern (Khan et al. 2013). The potential for HMs contamination of agricultural food products is of concern in many countries (Lone et al. 2008). Metal accumulation in plants varies within and between species and stages of plant development, and is dependent on soil and metal type and environmental conditions (Asami 1981; Khairiah et al. 2004; Singh et al. 2012). Soybean (Glycine max [L.] Merr.) is one of the world’s most important economic legume crops. It was demonstrated to have a higher potential for absorption and accumulation of HMs compared to numerous other crops including wheat (Lavado et al. 2001), rice (Li et al. 2008), bean and peas (Angelova et al. 2003). Several investigations have assessed the potential of health risks involved in the accumulation of HMs in soybean cultivated in contaminated areas (Angelova et al. 2003; Shute & Macfie 2006). Among the HMs pollutants, Cd is considered to be one of the most phytotoxic. Because of its high solubility it is *Corresponding authors. Email: peter.socha@uniag.sk, ildiko.matusikova@savba.sk Ó 2015 Taylor & Francis Downloaded by [Max Perutz Library] at 05:22 20 May 2015 2 P. Socha et al. easily taken up by plants, and its accumulation results in various toxicity symptoms such as root and shoot growth inhibition, leaf chlorosis, morphological alterations and plant death (Yadav 2010). Cd toxicity damages the photosynthetic apparatus, decreases carbon assimilation, induces alteration of cell cycle and division and disturbs cellular redox control (reviewed by DalCorso et al. 2010). In humans, excessive intake can induce chronic toxicity (Jackson & Alloway 1992). Crops, including soybean, are recognized as the main source of Cd intake by humans (Ryan et al. 1982). Therefore, it is not surprising that numerous organizations have set maximum limits for Cd concentrations in edible crops, including soybean. The Codex Alimentarius Commission, the WHO (CCFAC 2001), and the Commission of the European Communities (2008) defined an upper limit of 0.2 mg kg 1 for Cd concentration in soybean seeds. Consequently, development of low-Cd soybean genotypes should be a priority (Arao et al. 2003; Arao & Ishikawa 2006). Variation among soybean cultivars in Cd uptake by the root and translocation to the shoot has been reported previously (Petterson 1977), and genetic factors were suggested to be involved in varietal differences in seed Cd concentration (Arao et al. 2003). Recently, genetic mapping and linkage analysis of the soybean genome have shown that low Cd accumulation in soybean seeds is controlled by a single dominant gene, Cda1, located in a major quantitative trait locus (QTL) on chromosome 9, on linkage group K (Benitez et al. 2010; Jegadeesan et al. 2010). Similarly, a dominant major gene controlling low Cd uptake was also found in other plants (Clarke et al. 1997; Tanhuanp€a€a et al. 2007). Several molecular markers tightly linked to Cda1 have been identified in soybean (Benitez et al. 2010, 2012; Jegadeesan et al. 2010) and used to screen soybean genotypes for low Cd accumulation. Markers for accumulation in plants are currently not available for most HMs. However, because HMs enter plants through low-specificity metal transporters in the plasma membrane (Rogers et al. 2000; Hall 2002; Schroeder et al. 2013), mechanisms for HM uptake and accumulation in plants may partially overlap between metals. Moreover, responses to abiotic stress in plants are often composed of general stress responses in addition to the specific responses (Vel
azquez & Balderas-Hern
andez 2013). Therefore, there is the potential that low Cd accumulation of a specific cultivar, together with high tolerance to Cd, may be accompanied by low accumulation and enhanced tolerance to other HMs as well. There is a lack of information about general stress responses to many of the HMs, as well as about the relation between the accumulation potential of metals and metal tolerance. In the present project, we have evaluated the hypothesis that in soybean cultivars Cd accumulation potential is a general marker for growth tolerance to other heavy metals (As, Cd, Al). Cd accumulation potential, determined by simple sequence repeat (SSR) marker analysis for Cda1, was compared with extent of growth sensitivity to Cd, As, Al and the non-heavy metal stressor, NaCl, in 22 varieties of soybean, to evaluate its effectiveness in screening for metal tolerance. The development of a tool for screening sensitivity to metal toxicity would be a valuable for breeders, and for molecular and physiological studies into mechanism of plant defense against specific metals. Materials and methods Plant material and growing conditions Twenty-two cultivars of soybean (Glycine max L.) were used as the model system of study. The selected varieties are commercial cultivars that are commonly grown in central Europe. They are manufactured by Saatbau Linz (Slovakia), Monsanto (Slovakia), and B
oly Agricultural Production and Trade Ltd (Hungary). The cultivars, and their respective countries of cultivation, are listed in Table 1. The seeds were surface-sterilized with 0.5% (v/v) sodium hypochloride for 10 min, rinsed five times in distilled water, and then germinated in Petri dishes lined Table 1. Soybean cultivars assessed in the present study. Cd accumulation potential based on SSR analysis identifying the presence of the Cda1 allele: “low”, the allele was found; “ ”, the allele was not found. All cultivars are common commercial cultivars in Europe. Cultivar Alma-Ata Bobita Bolyi 44 Bolyi 56 Boroka Borostyan Bristol BS 31 Cardiff Chernyatka Color Cordoba Crusader Essor Evans Kent Kyivska 98 Merlin Primus Sigalia Ustya Vorskla a Countries of cultivation Cd accumulation potential Austria, Germany, Slovakia Hungary Hungary Hungary Hungary Hungary Hungary, Slovakia Hungary, Slovakia Austria, Hungary, Slovakia Ukrainea Austria Austria, Hungary, Slovakia Hungary, Italy Austria, France Hungary Austria Ukraine Austria, Latvia Austria, Germany, Slovakia Austria, France Ukraine Ukrainea Not listed in the EU database of registered plant varieties. Low Low Low Low Low Low Low Low Low Low Low Low Israel Journal of Plant Sciences Downloaded by [Max Perutz Library] at 05:22 20 May 2015 with two layers of water-moistened filter paper (Whatman No 1) in the dark at 25 C for 2 3 days. Seedlings with uniformly germinated roots, 8 10 mm long, were transferred to new Petri dishes, 10 15 seeds per Petri dish, also containing two layers of filter paper moistened with distilled water (control) or ecologically relevant concentrations of the stressors. The concentrations applied were 44.4 mmol dm¡3 (5 mg dm¡3) of Cd2C, 66.7 mmol dm¡3 (5 mg dm¡3) of As3C and 80 mmol dm¡3 of Al3C, prepared from Cd(NO3)2.4H2O (Centralchem, Bratislava, Slovakia), As2O3 (Merck, NY, USA) (Tamari et al. 1988) and AlCl3 (Merck, NY, USA). For comparison, 50 mmol dm¡3 of NaCl was applied as a non-HM stressor. The measurements were conducted with three replicates, each containing 10 15 seeds. Root growth response Root growth response to the metal treatments was used to determine the extent of sensitivity of the cultivars to the stressors. Root fresh biomass was measured following 48 h of exposure to the treatments and dry weight was determined following 24 h desiccation at 60 C. All measurements were performed in three replications. Fresh and dry weights of the roots of 10 15 seedlings per cultivar were measured for each replicate. To facilitate comparison between cultivars and stressors, the biomass results for the treated plants were normalized as % of the nontreated controls. The normalized values, termed ‘tolerance indexes’ (TIs), are presented as percentage of control: TI D (root weight of treated plants / root weight of untreated plants) £ 100% (Table 2). DNA isolation and marker analysis The young growing tissue from the basal 10 mm of the root tip was used for the analyses. Sections from three root tips (100 120 mg) were combined for each sample, and immediately following excision were ground in liquid nitrogen. DNA was isolated with the DNeasy Plant Mini Kit (Qiagen, Germany). DNA from each soybean cultivars was quantified using BioSpec-nano Spectrophotometer (Shimadzu, Japan). SSR markers (SatK147, SacK149 and SaatK150) were used for polymerase chain reaction (PCR) amplification on soybean DNA as described previously (Jegadeesan et al. 2010). They were identified by linkage analysis to be tightly linked markers flanking Cda1 in soybean, and to effectively differentiate between high and low Cd-accumulating soybean genotypes (Jegadeesan et al. 2010). The primer sequence information is given in Table 3. The PCR products were analyzed after separation in high-resolution 3% (w/v) agarose gels. The primer pairs produced fragments with expected size of 200 300 bp. 3 Table 2. Tolerance indexes (i.e. root biomass % of control) of soybean roots upon exposure to Cd, As, Al and NaCl. Tolerance indexes (%) Cultivar Alma-Ata Bobita Bolyi 44 Bolyi 56 Boroka Borostyan Bristol BS 31 Cardiff Chernyatka Color Cordoba Crusader Essor Evans Kent Kyivska 98 Merlin Primus Sigalia Ustya Vorskla Cd As Al NaCl 97.97 96.30 87.01 91.10 98.81 94.90 95.97 94.92 86.10 97.71 105.91 98.97 103.23 95.95 84.64 97.35 84.08 91.61 90.99 107.71 91.84 94.47 74.64 71.58 67.18 69.60 75.70 76.87 96.58 71.72 70.47 90.86 89.69 89.55 99.17 87.29 75.33 87.25 71.34 69.33 79.81 75.49 78.64 81.03 112.97 100.06 88.29 87.80 105.34 102.33 97.30 82.24 94.77 96.20 93.94 97.30 103.83 92.51 98.21 96.83 80.40 85.06 125.50 141.26 95.20 103.55 101.18 89.41 83.73 92.40 89.39 93.57 98.20 85.96 90.43 84.50 100.47 97.58 86.87 96.74 82.14 93.67 86.94 81.78 86.74 92.87 92.55 89.12 Statistical analyses Similarities and/or differences in the effects of the different stressors on roots of the tested soybean cultivars were analyzed by cluster analyses using Ward’s method (which uses an analysis of variance approach to evaluate the distances between clusters; Ward 1963), based on Euclidean distance. To identify natural groupings of objects and confirm the results of the clustering analyses, a principal component analysis (PCA) was performed with four variables (Cd, As, Al, NaCl). The relationship between Cd accumulation potential and tolerance (based on root response) was analyzed by logistic regression. The statistical analyses were performed with the program Statistica 9 (version 9, Tulsa, OK, USA). Results and discussion Cultivar selection is an appealing method for changing HM accumulation in crops as it affects the concentration in the edible plant parts and can reduce the need for adjustment of other agro-techniques such as soil leaching and fertilization. Increased human health concerns and new marketing regulation motivates efforts towards the production of lowCd cultivars of edible crops (Grant et al. 2008). Genetic variability in Cd uptake was reported previously for 4 P. Socha et al. Table 3. Primer sequences. Primer sequence (5ʹ 3ʹ) Marker name SatK147 SacK149 SaatK150 Forward Reverse CCATGGATATCTCCTAATCTCCTG TGAACACATGCTCAACTTGTCA TGATGTCTCCGTACATAAAAGATCAC TCTGCAAATTAAAACTTAGAGGGTG CGTGTGGTTGCTATTAACTAAATGA CTTCAACCATACGCTTGTGAA Downloaded by [Max Perutz Library] at 05:22 20 May 2015 soybean (Arao & Ae 2001; Arao et al. 2003; Ishikawa et al. 2005; Morrison 2005; Arao & Ishikawa 2006), and the considerable variability in Cd accumulation between soybean cultivars can be utilized by plant breeders for the selection of genetically low-Cd accumulators. Cadmium accumulation capacity and metal tolerance in soybean cultivars SSR markers for the Cda1 gene revealed that more than half (12) of the examined soybean cultivars carry the allele for low-Cd accumulation (Table 1). Therefore, almost half of the common soybean cultivars grown in Europe can be considered a potential health risk in terms of cultivation in Cd-polluted areas. The reliability of the markers used has been confirmed on a large set of soybean cultivars and was found to correlate with about 60% of the phenotypic variability in Cd accumulation (Jegadeesan et al. 2010). The deposition rate of Cd for new varieties assessed should also be validated experimentally, and in the present study was accordingly confirmed for the cultivars Bolyi 44, Cordoba, Kyivska 98 and Chernyatka (data not shown). Roots, which are the first plant organ to encounter the toxic soil pollutants, are often reported to be more sensitive to HM toxicity than shoots (Breckle 1991; Hasnian et al. 1993; Elloumi et al. 2007). HM exposure is known to induce structural and morphological changes in roots, inhibit root elongation, branching and root hair growth and thereby root biomass accumulation (Fernandez & Henriques 1991; Hasnian et al. 1993). The effect of HMs on root biomass is therefore considered a good indicator for metal stress tolerance and sensitivity (Bekesiova et al. 2008; Pirselova et al. 2011). The potential for metal accumulation in plants can be a genetically independent character (at least partially) of metal tolerance, as was previously shown for wheat (Ci et al. 2012), Arabidopsis halleri (Bert et al. 2003) and Thlaspi caerulescens (Zha et al. 2004). In agreement with these reports, soybean cultivars of both high and low potential for Cd accumulation revealed a wide range of root growth tolerance to Cd (Figure 1), confirming the low level of correlation between root growth inhibition and metal accumulation (chi-square D 0.62, df D 1, p D 0.428). High variability among cultivars in tolerance to metals has been described for many plant species including soybean (Metwally et al. 2005; Sugiyama et al. 2007). Figure 1. Tolerance index to Cd of 22 cultivars of soybean grown commercially in central Europe. Asterisks indicate cultivars bearing the allele for low Cd accumulation potential, based on SSR marker analysis. Each data point represents a tolerance index for a single cultivar under Cd stress (i.e. root dry weight expressed as % of control). Data are averages §S.E. (n  50 roots). Israel Journal of Plant Sciences 5 Downloaded by [Max Perutz Library] at 05:22 20 May 2015 Figure 2. Clustering analysis of the tested soybean cultivars based on root tolerance indexes to the HMs Cd, As and Al, and the nonHM stressor NaCl (a). Plots of individual clusters revealed that the level of tolerance to Al appears to differentiate clusters C1 C4 most markedly (b). Clustering analysis grouped all soybean cultivars into four different clusters based on level of metal tolerance (Figure 2a). Data on salt tolerance do not appear to affect this distribution (Figure 2b). Cluster C2, of seven cultivars, was identified as the most tolerant to all stress types. In contrast, cluster C1 consisted of eight cultivars that were overall more sensitive to the evaluated metals compared to the remaining cultivars. The C3 cluster includes two highly Al-tolerant cultivars that responded to the remaining stressors similarly to the five cultivars of cluster C4, which demonstrated intermediate tolerance to the tested stressors. These results suggest that the screening of soybean cultivars for tolerance to several metals may allow the selection of cultivars with general tolerance to metals. The soybean cultivars reveal a differential response to the evaluated stressors Principal component analysis (PCA) revealed the effects of two major factors that accounted for 76.96% of the variability in the response of the soybean root growth to the individual stressors (Figure 3a). In general, all four stress types affected the growth of the soybean roots (factor 1 accounted for 54.30% of the variability) and the mildest effects were observed for the Al and Cd treatments. Root growth inhibition is well documented as the first visual response to toxicity of numerous heavy metals or metalloids (Ebbs & Kochian 1997; Liao et al. 2006) that is often followed by reduced length or branching, and overall poorly developed roots. Induction of root growth inhibition by the individual stressors (factor 2 accounted for 22.66% of the observed variability: Figure 3b) reflects a negative relation for Cd and Al, because for both not only root inhibition but also hormesis (i.e. a favorable biological response to low exposures to a stressor) were observed for some cultivars. In contrast, only inhibition was observed for As and NaCl, indicating a similar potency of these two stressors. For roots of all tested soybean cultivars the responses were in general most diverse for the Al treatment and decreased in the order of Al > As > Cd > NaCl. At the same time, Euclidean distances, reflecting the impacts of the applied doses, were closest for NaCl and Cd (33.6), and most diverse between As and Al (117). A possible explanation for this effect is heritability and natural variability resulting from gene products and production of simple low-molecular compounds that is unrelated to exposure to any abiotic stress (Baker 1987; Maestri & Marmiroli 2012). A smaller portion of the observed variability (15.49%) in root response to the four stressors (factor 3, Figure 3b) could be attributed to their chemical nature. While Cd and As bind similar ligands in plants, Al and NaCl exert diverse effects from both Cd and As, as well as between each other. Thus Cd and As exert more similar effects on soybean roots in contrast to the light metal Al, while the effect of NaCl is dissimilar to all tested metal(loid)s. Such distribution might suggest whether similar or different defense mechanisms are being activated in soybean roots. For example, the tolerance mechanism to Al toxicity in many plants (including soybean) involves the exclusion of Al from the root cells by exertion of organic acids, such as citrate or malate, that chelate Al (Ma 2000; Watanabe & Osaki 2002; Liao et al. 2006). The success/failure of this first line of defense rapidly impacts nutrient uptake and root growth. In contrast, the mechanism mediating detoxification of Cd and As implicates phytochelate synthesis (Cobbett 2000), while salt tolerance capability in soybean is based on mechanisms distinct from heavy metals and metalloids tolerance mechanisms, and consists of various metabolic physiological and structural adaptations. In conclusion, the SSR analysis identified soybean cultivars with potential health risk when grown in metalpolluted areas, regardless of their natural tolerance. The Downloaded by [Max Perutz Library] at 05:22 20 May 2015 6 P. Socha et al. Figure 3. Scatter plot of the tested soybean cultivars based on the root tolerance indexes values to Cd, As, Al and NaCl. The two asterisks correspond to members of Cluster 3 (a). Components weights plot of tested soybean cultivars reflecting to relations of impacts of individual stresses (b). identification of such cultivars can be used as a tool to reduce contamination risks of edible crops with toxic heavy metals and metalloids. Furthermore, the identification and selection of cultivars most tolerant to abiotic stresses brings a promise for soybean breeding programs for possible production of “super-tolerant” cultivars, not only for cultivation in contaminated soils but also in difficult environmental conditions in general. The results revealed differential effects of individual metal stressors and therefore point at distinct defense mechanisms. Confirming this hypothesis with physiological, biochemical and molecular measurements will provide a starting point for identification of additional markers applicable for breeders in marker assisted selection. Funding This work was supported by the Slovak Grant Agency VEGA under grant nos. 2/0090/14 and 1/0061/15. Financial support for P. Socha was provided by the Operational Programme Research and Development for the project Implementation of the Research of Plant Genetic Resources and its Maintaining in the Sustainable Management of Slovak Republic (ITMS: 26220220097), co-financed from the resources of the European Union Fund for Regional Development. References Angelova V, Ivanova R, Ivanov K. 2003. Accumulation of heavy metals in leguminous crops (bean, soybean, peas, lentils and gram). J Environ Prot Ecol. 4:787 795. Arao T, Ae N. 2001. Screening of genotypes with low cadmium content in soybean seed and rice grains. In: Plant nutrition: food security and sustainability of agro-ecosystems through basic and applied research. Fourteenth International Plant Nutrition Colloquium. Hannover. Germany, p. 292 293. Arao T, Ae N, Sugiyama M, Takahashi M. 2003. Genotypic differences in cadmium uptake and distribution in soybeans. Plant Soil. 251:247 253. Arao T, Ishikawa S. 2006. Genotypic differences in cadmium concentration and distribution of soybean and rice. JARQJpn Agr Res Q. 40:21 30. Asami T. 1981. Maximum allowable limits of heavy metals in rice and soil. In: Kitagawa K, Yamane I, editors. Heavy metal pollution in soils of Japan. Tokyo: Japan Scientific Societies Press; p. 257 274. Baker AJM. 1987. Metal tolerance. New Phytol. 106:93 111. Bekesiova B, Hraska S, Libantova J, Moravcikova J, Matusikova I. 2008. Heavy-metal stress induced accumulation of chitinase isoforms in plants. Mol Biol Rep. 35:579 588. Benitez ER, Hajika M, Takahashi R. 2012. Single-base substitution in P1B-ATPase gene is associated with a major QTL for seed cadmium concentration in soybean. J Hered. 103:278 286. Benitez ER, Hajika M, Yamada T, Takahashi K, Oki N, Yamada N, Nakamura T, Kanamaru K. 2010. A major QTL controlling seed cadmium accumulation in soybean. Crop Sci. 50:1728 1734. Bert V, Meerts P, Saumitou-Laprade P, Salis P, Gruber W, Verbruggen N. 2003. Genetic basis of cadmium tolerance and hyperaccumulation in Arabidopsis halleri. Plant Soil. 249:9 18. Breckle SW. 1991. Growth under stress: heavy metal. In: Waisel Y, Eshel A, Kafkafi U, editors. Plant roots: the hidden half. New York: Marcel Dekker; p. 351 373. CCFAC (Codex Alimentarius Commission). 2001. Report of the 33rd Session of the Codex Alimentarius Committee on Food Additive and Contaminants. The Hague, pp 285 Ci D, Jiang D, Li S, Wollenweber B, Dai T, Cao W. 2012. Identification of quantitative trait loci for cadmium tolerance and accumulation in wheat. Acta Biol Plantarum. 34:191 202. Clarke JM, Leisle D, Kopytko GL. 1997. Inheritance of cadmium concentration in five durum wheat crosses. Crop Sci. 37:1722 1726. Cobbett CS. 2000. Phytochelatins and their roles in heavy metal detoxification. Plant Physiol. 123:825 832. Downloaded by [Max Perutz Library] at 05:22 20 May 2015 Israel Journal of Plant Sciences Commission of the European Communities. 2008. Amending Regulation (EC) No. 1881/2006 setting levels for certain contaminants in foodstuffs. Official Journal of the European Union. L 173/8 DalCorso G, Farinati S, Furini A. 2010. Regulatory networks of cadmium stress in plants. Plant Signal Behav. 5:663 667. Ebbs SD, Kochian LV. 1997. Toxicity of zinc and copper to Brassica species: implications for phytoremediation. J Environ Qual. 26:776 781. Elloumi N, Ben F, Rhouma A, Ben B, Mezghani I, Boukhris M. 2007. Cadmium induced growth inhibition and alteration of biochemical parameters in almond seedlings grown in solution culture. Acta Physiol Plant. 29:57 62. Fernandez JC, Henriques, FS. 1991. Biochemical, physiological, and structural effects of excess copper in plants. Bot Rev. 57:246 273. Grant CA, Clarke JM, Duguid S, Chaney RL. 2008. Selection and breeding of plant cultivars to minimize cadmium accumulation. Sci Total Environ. 390:301 310. Hall JL. 2002. Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot. 53:1 11. Hasnian S, Yasmin A, Yasmin S. 1993. The effect of lead resistant Pseudomonads on the growth of Triticum aestivum seedlings under lead stress. Environ Pollut. 81:179 184. Ishikawa S, Ae N, Sugiyama M, Murakami M, Arao T. 2005. Genotypic variation in shoot cadmium concentration in rice and soybean in soils with different levels of cadmium contamination. Soil Sci Plant Nutr. 51:101 108. Jackson AP, Alloway BJ. 1992. The transfer of cadmium from agricultural soils to the human food chain. In: Adriano DC, editor. Biogeochemistry of trace metals. Boca Raton, FL: Lewis Publishers; p. 109 158. Jegadeesan S, Yu K, Poysa V, Gawalko E, Morrison MJ, Shi C, Cober E. 2010. Mapping and validation of simple sequence repeat markers linked to a major gene controlling seed cadmium accumulation in soybean [Glycine max (L.) Merr]. Theor Appl Genet. 121:283 294. Khairiah T, Zalifah MK, Yin YH, Aminath A. 2004. The uptake of heavy metals by fruit type vegetables grown in selected agricultural areas. Pak J Biol Sci. 7:1438 1442. Khan R, Srivastava R, Abdin MZ, Manzoor N, Uzzafar M. 2013. Effect of soil contamination with heavy metals on soybean seed oil quality. Eur Food Res Technol. 236:707 714. Lavado RS, Porcelli CA, Alvarez R. 2001. Nutrient and heavy metal concentration and distribution in corn, soybean and wheat as affected by different tillage systems in the Argentine pampas. Soil Till Res. 62:55 60. Li YH, Yang LS, Ji YF, Sun HF, Li HR, Wang WY. 2008. Lead uptake by plant in soil-plant system at lead-zinc deposit area of Western Hunan Province. Huan Jing Ke Xue. 29:196 201. Liao H, Wan H, Shaff J, Wang X, Yan X, Kochian LV. 2006. Phosphorus and aluminum interactions in soybean in relation to aluminum tolerance, exudation of specific organic acids from different regions of the intact root system. Plant Physiol. 141:674 684. Lone MI, He ZL, Stoffella PJ, Yang XE. 2008. Phytoremediation of heavy metal polluted soils and water: progresses and perspectives. J Zhejiang Univ Sc B. 9: 210 220. Ma JF. 2000. Role of organic acids in detoxification of aluminum in higher plants. Plant Cell Physiol. 41:383 390. Maestri E, Marmiroli M. 2012. Genetic and molecular aspects of metal tolerance and hyperaccumulation. In: Gupta DK, Sandalio LM, editors. Metal toxicity in plants: perception, View publication stats 7 signaling and remediation. Heidelberg: Springer-Verlag Berlin; p. 41 63. Metwally A, Safronova VI, Belimov AA, Dietz KJ. 2005. Genotypic variation of the response to cadmium toxicity in Pisum sativum. J Exp Bot. 56:167 178. Morrison M. 2005. Cadmium concentration in Canadian soybean. The Pulse Beat Manitoba Pulse Growers Association. 47:33 34. Peralta-Videa JR, Lopez ML, Narayan M, Saupe G, Gardea-Torresdey J. 2009. The biochemistry of environmental heavy metal uptake by plants: implications for the food chain. Int J Biochem Cell Biol. 41:1665 1677. Petterson O. 1977. Differences in cadmium uptake between plant species and cultivars. Swed J Agr Res. 7:21 24. Pirselova B, Kuna R, Libantova J, Moravcikova J, Matusikova I. 2011. Biochemical and physiological comparison of heavy metal-triggered defense responses in the monocot maize and dicot soybean roots. Mol Biol Rep. 38:3437 3446. Rogers EE, Eide DJ, Guerinot ML. 2000. Altered selectivity in an Arabidopsis metal transporter. Proc Natl Acad Sci USA. 97:12356 12360. Ryan JA, Pahren HR, Lucas JB. 1982. Controlling cadmium in the human food chain: a review and rationale based on health effect. Environ Res. 28:251 302. Schroeder JI, Delhaize E, Frommer WB, Guerinot ML, Harrison MJ, Herrera-Estrella L, Horie T, Kochian LV, Munns R, Nishizawa NK, et al. 2013. Using membrane transporters to improve crops for sustainable food production. Nature. 497:60 66. Shute T, Macfie SM. 2006. Cadmium and zinc accumulation in soybean: a threat to food safety? Sci Total Environ. 371:63 73. Singh S, Zacharias M, Kalpana S, Mishra S. 2012. Heavy metals accumulation and distribution pattern in different vegetable crops. J Environ Chem Ecotoxicol. 4:170 177. Su C, Jiang L, Zhang W. 2014. A review on heavy metal contamination in the soil worldwide: situation, impact and remediation techniques. Environ Skept Crit. 3:24 38. Sugiyama M, Ae N, Arao T. 2007. Role of roots in differences in seed cadmium concentration among soybean cultivars proof by grafting experiment. Plant Soil. 295:1 11. Tamari Y, Takada A, Tsuji H, Kusaka Y. 1988. Determination of ppb level of arsenic(V) based on fluorescence quenching of thorium-morin chelate. Anal Sci. 4:277 280. Tanhuanp€a€a P, Kalendar R, Schulman AH, Kiviharju E. 2007. A major gene for grain cadmium accumulation in oat (Avena sativa L.). Genome. 50:588 594. Vel
azquez SF, Balderas-Hern
andez VE. 2013. Abiotic stress in plants and metabolic responses. In: Vahdati K, Leslie C, editors. Abiotic stress plant responses and applications in agriculture. Rijeka: InTech, p. 418. Ward JH. 1963. Hierarchical grouping to optimize an objective function. J Amer Stat Assoc. 58:236 244. Watanabe T, Osaki M. 2002. Mechanisms of adaptation to high aluminum condition in native plant species growing in acid soils: a review. Commun Soil Sci Plan. 33:1247 1260. Yadav SK. 2010. Heavy metals toxicity in plants: an overview on the role of glutathione and phytochelatins in heavy metal stress tolerance of plants. S Afr J Bot. 76:167 179. Zha HG, Jiang RF, Zhao FJ, Vooijs R, Schat H, Barker JHA, McGrath SP. 2004. Co-segregation analysis of cadmium and zinc accumulation in Thlaspi caerulescens interecotypic crosses. New Phytol. 163:299 312.