zyxwvutsrqp zyxwvutsrqp zyxwvuts zyxwvu zyxwv BotaniculJoumal ofthe Linnean Socieb (1997), 125: 183-199. With 1 figure KLAUS MUMMENHOFF, ANDREAS FRANZKE AND MARCUS KOCH Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 zyxw zyxw Molecular data reveal convergence in fruit characters used in the classification of ThZaspi s.1. (Brassicaceae) zyxwvuts Spezielle Botanik, FB Biologae, Universitat Osnabriick, BarbarastraJe 11, 49076 Osnabriick, Gemzany Received Februaly 1997; accepted for publication M q 1997 Phylogenetic relationships of 18 7hlmpi s. 1. species were inferred from nuclear ribosomal internal transcribed spacer (ITS) sequence data. These species represent all sections of the basic classification system of Schulz primarily based on fruit characters. The molecular phylogeny supported six clades that are largely congruent with species groups recognized by Meyer on the basis of differences in seed coat anatomy, i.e. Thtaspi s. s., 7?tknpiceras, Xoccaza (Raparia included), Microthknpi, Vania and Nmmtropzi. Some of these lineages include species which are morphologically diverse in fruit shape (e.g. 7hlarpi s. 5.: Z amewe - fruits broadly winged, I: ceratocarpum - fruits with prominent horns at apex, 7: alliaceum - fruits very narrowly winged). Furthermore, the same fruit shape type is distributed among different clades. For instance, fruits with prominent horns at apex are found in Thlaspi s.s. (Z ceratocarpum) and 7hhpiceras (7: oxyceras). These results clearly indicate convergence in fruit characters previously used for sectional classification in Thknpi s. 1. 0 1997 The Linnean Societv of London ADDITIONAL KEY WORDS:-internal nuclear ribosomal DNA. transcribed spacer - molecular phylogeny - CONTENTS Introduction . . . . . . . . . Material and methods . . . . . Plant material . . . . . . ITS amplification and sequencing Phylogenetic analysis . . . . Results . . . . . . . . . . ITS size and sequence variation . Phylogenetic analysis . . . . Discussion . . . . . . . . . Acknowledgements . . . . . . References . . . . . . . . . Appendix I . . . . . . . . . Appendix 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 . . . . . . . . . . 188 188 . . . . . 188 . . . . . . . . . . 189 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184 185 185 190 192 192 194 195 zyxwvuts zyxwvu Correspondence to: Dr K. Mummenhoff. Email: mummenhoff@cipfb5.biologie.Uni-Osnabrueck.De 0024-4074/97/110183+ 17 $25.00/0/bt970116 183 0 1997 The Linnean Society of London 184 zyxwvutsrqpo zyxwvu zyxwvutsrqp zyx zyxwvuts zy z zyxw K. MUMMENHOFF E T A . INTKODUCI‘ION Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 Ihlaspi L. s. 1. is one of the largest genera of the Brassicaceae and comprises approximately 75 species (Schulz, 1936; Al-Shehbaz, 1986). Several controversial classification schemes for sections have been proposed, primarily based on fruit morphology, but no explicit phylogenetic treatment of morphological data has been attempted so far (Schulz, 1936; Bush, 1939; Clapham, 1964; Hedge, 1965; Table 1). Meyer (1 973, 1979) questioned the naturalness of these intrageneric lineages, and he proposed a radical revision of lhlaspi s. 1. inferred from differences in seed coat anatomy: Ihlaspi s. 1. was split into 12 segregate genera, the differences between them were considered too great to warrant their subordination, as sections or subgenera, to a single broadly defined genus. Only six species were retained in irhlaspi S.S. whereas the bulk of l h h p i taxa, formerly placed in Thlaspi sections Aptqvgzum Ledeb. and pteroh~pisDC. by Schulz (1936)were distributed among several sections of Noccaea Moench by Meyer (1973). This treatment, however, has not received support by recent authors (Al-Shehbaz, 1986; Greuter, Burdet & Long, 1986; Hedge, 1988). Recently, we have studied lhlaspi species from all five sections sensu Schulz (1936)by isoelectric focusing analysis of Rubisco subunits (Mummenhoff st Zunk, 1991; Koch, Murrirnerihoff Clr Lunk, IYYY), restriction site analysis of chloroplast (cp)DN.4 (Mummenhoff& Koch, 1994)and sequence analysis of internal transcribed spacer (ITS) regions of nuclear ribosomal DNA (Mumrnenhoff, Franzke & Koch, 1997). lhlaspis. 1. lineages detected in our molecular phylogenies correspond to Meyer’s (1973, 1979) segregates lhlaspi s. s., Microthhpi F.K. Meyer, and Noccaea Moench with Raparia F.K. Meyer included. It has often been suggested that many of the difficulties in resolving phylogenetic relationships in Brassicaceae may be due to reliance on morphological characters (e.g. fruit and flower morphology) which have undergone convergent evolution (Dvorak, 1971; Eigner, 1973; Hedge, 1976; Avetisian, 1983; Endress, 1992). Fruit shape and elaboration of the wing of the fruit is hypothesized to be particularly convergent in I h h p i s. 1. taxa (Meyer, 1979) although these characters have been primarily used for previous intrageneric classifications (Schulz, 1936; Clapham, 1964; Hedge, 1965); therefore, analysis of these fruit characters can easily lead to incorrect phylogenetic conclusions (Sytsma, 1990). The utility of sequence analysis of ITS regions of nuclear ribosomal DNA for reconstructing phylogenetic relationships within and among closely related genera has been reviewed adequately (Baldwin et al., 1995). The current study is a continuation of our previous molecular work with 7Ilaspi s. 1. using selected members of all sections s m u Schulz (1936; Table 1). In addition, we have included six representative species of Meyer’s segregates Ihlmpiceras F.K. Meyer, kniu F.K. Meyer and JVeurotr0pi.s (DC.)F.K. Meyer (Table 1). We conducted a phylogenetic sequence analysis of ITS regions of nuclear ribosomal DNA to achieve two goals. First, we hoped that this new and independent data set would help to elucidate phylogenetic relationships of species from irhlaspi sect. Carpoceras DC., ?;lllmpicerm and Vania s m Meyer. These species were classified by previous authors (Bush, 1939; Hedge, 1965) into sections mainly based on fruit characters (presence/absence of fruit wings or of well developed horns at fruit apex) that may have undergone convergent evolution. Second, this study included seven out of the twelve segregates of Meyer’s radical revision (Table 1) and, therefore, our approach offered the opportunity to reach a step further in the evaluation of Meyer’s concept. zyxw zyxwvu zyxwvut zyxwvu ITS DNA PHYLOGENY OF THLASPZ 185 MATERIAL AND METHODS Plant material Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 zyx DNAs from 18 irhlaspi s. 1. taxa were examined. Collection data and source of plant material are given in Appendix 1. Voucher specimens are either deposited in the herbarium of the University of Osnabruck (OSBU) or they are kept at those herbariahstitutions providing specimens (see Appendix 1). Species analysed in this study represent a broad spectrum of the variation in i?zlaspi s. 1. including representatives of all sections sensu Schulz (1936) and they correspond to seven segregates out of the 12 defined by Meyer (1973, 1979) (Table 1). Systematic evaluation of the remaining five segregates was not performed because (1) these taxa are distributed in the Middle East (Kurdistan, Caucasus, Armenia, Iran) where sampling is not possible at the moment; (2) these taxa were not available from collections or herbaria, and (3) when available, we were not successful (despite intensive efforts) in the PCR amplification of ITS regions from these specimens, mostly collected in the last century. Nevertheless, taxa considered here would allow us to address to the principal goal of the present study, that is, whether fruit characters, traditionally important in sectional classification of irhlaspi s. l., are fraught with convergence (Table 1). Because generic bounderies in subtribe Thlaspidinae (tribeLepidieae)are unsettled, we used two species of the genus Lpidium (subtribe Lepidiinae; L. sativum, L. virginicum as outgroup taxa) as in our previous analyses (Mummenhoff & Koch, 1994; Mummenhoff et al., 1997) zyx ITS ampl$cation and sequencing Fresh or dry leaves (from herbarium specimens) were taken from individual plants. Total DNA was isolated following the procedure of Doyle & Doyle (1987) as modified in Mummenhoff & Koch (1994). Double stranded DNA of the ITS-1 and ITS-2 regions were amplified using the polymerase chain reaction (PCR) protocol given in Mummenhoff et al. (1997). Primer 18 F was modified as described in Mummenhoff et al. (1997, fig. 1). Amplification products were purified using the Quiaquick PCR Purification Kit (Quiagen, Hilden, Germany). Purified DNAs were sequenced by the dideoxy chain termination method (Sanger, Nicklen & Coulsen, 1977)using the Jinol kit (Serva, Heidelberg, Germany), following the protocol in Mummenhoff et al. (1997). The four primers used for sequencing both strands of the ITS-1 and ITS-2 regions were 18 F, 5.8 F, 5.8 R and 25 R (for details see Mummenhoff et ah, 1997). Boundaries of the coding and spacer regions were determined by comparison of our sequences to that of Sinupis a h a L. (Rathgeber & Capesius, 1989).DNA sequences were aligned visually by sequential painvise comparison (Swofford & Olsen, 1990). Regions with ambiguous alignment were eliminated from phylogenetic analyses. The alignment required the introduction of 22-bp indels (insertions/deletions) scattered among ITS-1 and 2. Although empirical studies have shown that different approaches of gap coding have only minimal, if any, effects on ITS tree topologies (reviewed in Baldwin et al., 1995)we investigated alternative scoring methods. First, gap positions were removed from the data matrix and only base substitutions were analysed. Second, gaps were coded as missing data. Third, gaps were treated as zyxwvutsrqpo zyxwvuts zyxwvu zyxwv TABLE 1. Distribution of seed and fruit characters and classification systems for 73larpi s. /. relative to the species studicd. Nomenclature of the spccics follows Appendix 1 with the exception of Meyer’s (1973, 1979) taxd zyxwvuts zyxwvuts zyxwvutsrqponml Seed coat‘ Schulz (1936y Clapham (1964)” Hedge (I 965)‘. Meyer (1973; 1979)”,‘ I. sect. Nomuma - 7: a m m e 7: sxt. .Nomima T YCCI. j\iomisma 771LASPI S.J. 7:sect. 7 l k u p i T amme - - 7: anm,se Epi . Fruit type# Pal --7:amensf --Orbicular, uniformly broad winged zyxwvutsrqponmlkji I reratocarpum 7: sect. Chaunothlaspt - 7: allmceum 7: sect. Carpoceras .- -.T ceratocarpum T sect. Chpocpms 7T reratocarpum --T alliaceum ‘T sect. Chaunothlaspi ----7: alliaceum -7T THUSPICERAS -7. oxyceras 0Xycera.r I 1 ---Prominent horns at apcx, valves wingless -----Obovate/ctbcordate , uniformly narrow winged I1 b -Narrowly prominent --Oblong, apex, very 111 b Ovate/oblong, not winged --Teiegans 7: sect. Aptqgium 7: kurdzcum VML4 l? kurdica l? campylophylla Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 T wct. Carpocerm obtriangular, horns at apex narrowly winged at minute apical horns zyxwvut zyxwvutsrqpon zyxwvutsrqponm zyxwvutsrqponml zyxwvutsrqpo 7: sect. Aptqgium --I: cepaeifolium subsp. mtundifolium T. sect. Ptemtropis (inc. Nacrot7uj1i.s) T. elegalzr 'I: montanum bulbosum 7; pdoliatum -Narrowly obovate, strongly keeled, wingless zyxwvutsrqp zyxwvutsrq zyxwvut zyxwvuts zy ir: sect. n h p i (incl. Nacmt7upi.s) 7: sect. Ptmtropis N. sect. Ptmtmpis IV T. elegans T. caerulescens N. montana N. caerulescens subsp. caerulescens subsp. calaminare 7:macranthum N. macrantha 7; -T. NOCCs1EA N. sect. Noccaea -X mtundifolia subsp. mtundifolia -I: sect. Aptqgium --I: cepmrlium subsp. mtundifolium b Obovate/triangular, more or less broadly winged at apex 3 alliacacm -1 bulbosum T. pe$oliatum T. sect. Thlarpi (=Nmrotropis) -T. bulbosum T. pqfdiatum RAPARLA -R. bulbosa V b -Obcordate, above MICRO THLASPI M. pegMatum M. natolicum VI b Obcordate/oval orbicular, broadly winged VII b Obcordate/orbicular uniformly broad winged M. granatense T. orbiculatum T. szozuitsianum NEUROTROPIS JV orbiculata N, szozuitsiana broadly winged 2 s0 4% i! h 2 o ~ c e r a s , Z kurduum, Z caerulescens, Z macranthum, 7:orbiculatam, and Z szowitsidnum were not recognized by Schulz. 7: cmatocarpum, I: oxy~eras, Z kurdicum, 7:elegans, 7:orbimhtum, and T szowitsianum do not occur in the area treated by Clapham (Flora Eumpaea). ' 7: cepaalolzum, 7: montanum, ?: macranthum, and 7: camlescens do not occur in Hedge's treatment (Flora 0s Turkq). a Z zyxwvutsrq %nia campylop&lla was given species rank by Meyer (1973). Meyer did not recognize subspecies within Noccaea caerulescens. Micmthlaspi ('Thhpi) granatense and M. (Ihlapi) natolicum were not recognized by Schulz (1 936), Clapham (1 964), and Hedge (1965). Epi =Epidermis, I: compressed cells without special structures, 11: Cells radially elongated with a protuberance (column) of dark mucilage from the inner tangential cell wall, 111: Cells with dense glassy content, IV: Cellsktangentially elongated without special structures, rarely mucilaginous, V: Mucilaginous cells & isodiametric with a minute protuberance from the inner tangential cell wall, VI: Cells mucilaginous, with a slight column on the inner tangential cell wall, VII: Cells mucilaginous. Mucilage swells in water and breaks through the cell wall, Pal=Palisade layer: a: Inner tangential and radial cell walls thickened, b: Cells without special/diagnostic structures. Data compiled from Vaughan & Whitehouse (1971) and Meyer (1973, 1979, 1991). KData compiled from the authon given in this table and from Bush (1939). I W U Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 180 zyxwvutsrqpon zyxwvu zyxwv K. MUhIMENHOFF E T d L zyxwvu zyxwvut missing in the body of the data matrix, but each gap was recoded as an additional presence/absence character. We focused on the third approach because indels may contain phylogenetic information, and, indeed may provide particularly clear indications of relationships (Baum, Sytsma & Hoch, 1994; Kron & King, 1996 and references therein). T o evaluate the non random structure of the ITS-sequence data, the skewness test (g, statistic) of Hillis & Huelsenbeck (1992) was used by calculating the treelength distribution of 10000 random trees (RANDOM TREES option in PAUP version 3.1.1; Swofford, 1993).The data matrix was analysed by assuming character states unordered and unweighted (i.e. Fitch parsimony) using the heuristic search strategy in PAUP with MULPARS, TBR (tree bisection-reconnection) branch swapping, and simple taxon addition. Homoplasy in the most parsimonious trees was estimated by the consistency index (CI) of Kluge & Farris (1969).Sets of equally parsimonious trees were summarized by the strict consensus approach. Bootstrap analyses (Felsenstein, 1985) with 100 replicates and decay analyses (Donoghue et al., 1992)were performed to obtain estimates of reliability for each monophyletic group. The decay index is the number of steps longer than the shortest trees at which a node collapses (decays).This index for individual clades was calculated by examining the strict consensus of all equal-length trees up to five steps longer than the shortest trees. Pairwise nucleotide differences of unambiguously alicgned positions were determined by the DISTANCE MATRIX option in PAUP. RESULTS ITS size and sequence ,variation The sizes of ITS- 1 and ITS-2 regions varied in length among irhlmpi s. 1. members from 248 to 277 bp (ITS-1) and 182 to 191 bp (ITS-2). No evidence of ITS length \rariants within each accession examined was detected. Proper alignment of ITS sequences resulted in a matrix of 481 characters and required the introduction of gaps (1 bp in length each) at 22 nucleotide sites (Appendix 2). Of these 481 sites it was necessary to delete 50 positions (ITS-1: sites 37-38 and 118-152; ITS-2: 301-31 3) prior to phylogenetic analysis because of alig-nment ambiguities. Of the remaining 43 1 unambiguously aligned nucleotide sites, 13 1 (30.4%; ITS- 1: 82, ITS2: 49) had at least two nucleotide states in two or more sequences and were potentially informative phylogenetically, 248 sites (57.5%) were unvarying, and 52 sites (1 2%) were unique to indkidual taxa. Sequence divergence was calculated using the DISTANCE MATRIX option available in PAUP.' Among irhlaspi s. 1. taxa and accessions painvise sequence divergence (ITS-1 and ITS-2 data combined) varied from 0.2% between two accessions of Microthlaspi granakme to 17.50/0between representatives of Thlaspi s. s. and ,%ccaea. These values are similar to those reported in the literature for congeneric or closely related genera (see Baldwin et al., 1995). Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 Phylagenetic anabsis zyxwv zyxwvuts zyxwvut zyxwvu zyxwv ITS DNA PHYLOGENY OF 7HUSPZ 189 zyxwv Phylogenetic anabsis Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 The results reported here first were obtained when indels were coded as missing in the body of the data matrix and then each indel scored and entered as a separate character. This added 22 presence/absence characters to the data matrix (see Material and methods, approach three). The g, statistic (skewness test) for 10 000 random trees generated from the data was - 1.1 (for 250 variable characters and 25 or more taxa, PCO.0 l), indicating that there is considerable nonrandom structure in our ITS-data (Hillis & Huelsenbeck, 1992, Table 2). Fitch parsimony analysis (heuristic search) resulted in four maximally parsimonious topologies of 35 1 steps with a consistency index (CI)of 0.70 1 (without autapomorphies).All of the differences among these four shortest trees occurred within the Noccaea/Raparia clade. The strict consensus tree (Fig. 1) is highly resolved and divides lhlaspi s. 1. into lineages with high bootstrap and decay support that are consistent with the respective genera of Meyer’s (1973, 1979) classification, i.e. lhlaspi s. s., lhlaspiceras, Kmia and Nmr0tmpi.s. The genus Raparia sensu Meyer is nested within the Noccaea clade. Microthlaspi is paraphyletic because M. granatense appears to be more closely related to Neurotropis/ Ihnia than to the core group of Microthlaspi. ITS-data is in full agreement with our previous conclusions as to the geographic partitioning of intraspecific chloroplast (cp)DNA variation in M. pdoliaturn (Mummenhoff & Koch, 1994).Diploid ‘northern’ accessions from Germany (PEN in Fig. 1) are clearly separated in cpDNA type and ITS sequences from polyploid populations (PESl/PES2 in Fig. 1) south of this region (discussed in Mummenhoff et al., 1997). As noted above (see Material and Methods), three approaches of coding indels were explored. Analysing the ITS data with all gap positions removed (approach one) and with the 22 indels only scored as missing data (approach two) resulted in three minimal length trees, respectively (not shown). The topologies of the two strict consensus trees were identical to that shown in Figure 1 (approach three) and, therefore, relationships among the l h h p i s. 1. lineages were precisely the same as those shown in Figure 1. zyxw DISCUSSION zyx Classification of lhlaspi s. 1. is difficult and unsettled as outlined above (Table 1). Our previous molecular analyses (IEF of Rubisco subunits: Mummenhoff & Zunk, 1991; Koch et al., 1993; cpDNA restriction site variation: Mummenhoff & Koch, 1994; ITS sequence variation: Mummenhoff et al., 1997) included representatives of all sections in lhlaspi s. 1. as defined by Schulz (1936) and Clapham (1964) and, therefore, represent a broad spectrum of the variation in lhlaspi s. 1. (Table 1). Phylogenies derived from these molecular studies provided support for Meyer’s (1973, 1979) classification scheme of ?hlaspi s. 1. (Fig. 1; see also Mummenhoff & Koch, 1994; Mummenhoff et al., 1997). Lineages recognized by us (Fig. 1) are well supported (bootstrap values: 72-1OO0/o; decay values: 3-2 5) and they are congruent with Meyer’s segregates lhlaspi s. s., Noccaea and Microthlaspi core group. Raparia is nested within the Noccaea clade. Paraphyly of Microthlaspi and the comparison of these lhlaspi s. 1. main lineages relative to previous classification systems (Table 1) are discussed in Mummenhoff & Koch (1994) and Mummenhoff et al. (1997). zyxwvu zyxwv zyxwvutsrqp zyxwvutsrqpo E zyxwv zyxwvutsrqponmlkjihgf K. MUMMENHOFF ETAL. Seed coat' Fruit typeb Epidermis Palisade Horns Wings layer atapex 95 I 1 Thlaspi LS 25 J ] Thlaspicems ' 4 a I1 ~ ~ ~ Neurotropis outgroup E pz::fk - -+; b V campylophylh kurdica a + - Noccaea 73 ~ { z ; : - I n 111 ~ b VII b + - - +/- + - - - - + + - Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 1 25 ~ aruense ceratocarpun alliaceurn zyxw - - + + Figure 1. Strict consensus of the four most parsimonious trees based on 7hla.sfii ITS sequence data (Appendix 2) with the distribution of seed coat and fruit characters. Gaps were treated as missing in the body of the data matrix, but each gap was recoded as an additional presence/absence character. The bootstrap support is shown above branches and decay index is given below. Tree length: 35 1, consistency index.(CI): 0.70 1, with autapomorphies excluded. See Appendix 1 for taxon abbreviations. The generic classification by Meyer (1973, 1979) is indicated by brackets. Lepidium sutivurn and L. iirginicum senred as outgroup. a Descriptions of epidermis types & \'I1 and of palisade layer types a and b is given in Table I . " Fruit characters are shown simplified as presence ( +), absence (-), intermediate ( +/ -) data matrix. For concise description see Table 1. The most important impetus for the current study was to examine the hypothesis by Meyer (1973, 1979), that the fruit characters previously used for infrageneric classification may be convergent among different irhlaspi s. 1. lineages. Therefore we have included in the molecular analysis representatives of Meyer's segregates 7hhpiceras (two species out of eleven), Enia (two of three) and Neurotropis (two of three). irhhpi s. 1. species characterized by wingless fruits but with prominent horns at the apex (e.g. T. ceratocarpum, T. ogceras) were previously classified in section Carpoceras (De Candolle, 1821; Hedge, 1965; see Table l ) , which was even treated as a separate genus by Boissier (1849) and Bush (1939). Based on differences in seed coat anatomy, Meyer (1973) retained only 7. ceratocarpum in Ihlaspi s. s. section Carpoceras (monotypic),whereas T. ovceras and T. eleganr represent a distinct lineage, i.e. Ihlaspiceras, despite some differences in fruit shape (T. oxyceras: fruits with prominent horns at apex; 7. ehgans: horns obsolete/minute). In this context Hedge (1965) noted that presence (7. oxyceras: sect. Carpoceras) and absence (7.elegans: sect. Pterottopis=Noccaea sect. Noccaea s m u Meyer, 1973; see Table 1) of well developed horns at fruit apex is apparently not a reliable sectional character. Both species are closely related and, therefore, section Carpoceras and Pterotropis sensu Hedge appeared zyxwvut zyxwvut zyxwvu ITS DNA PHYLOGENY OF THUSPZ 191 to be rather artificially delimited. Four additional species characterized by fruits with acute horns at apex were distributed by Meyer (1973, 1979) into Kotschyella F.K. Meyer and Noccidium F.K. Meyer, respectively, based on seed coat analysis. Unfortunately, these species were not available for ITS-analysis. Our molecular analysis would contradict the above mentioned hypotheses of De Candolle (1 82 l), Boissier (1849), Bush (1939) and Hedge (1965)’ but they would explicitly support Meyer’s view (Fig. 1): Thlaspi ceratocarpum is in the Thluspi s. s. clade, obviously separated from the Th1aspicera.s clade (T.oxyceras, T. elegans) which appears as sister to the Noccaea/Raparia lineage. Section Neurotropis is included in sect. Apteygium in the systems of Schulz (1936) and Clapham (1964) but is recognized as a separate taxon in the classification schemes of Bush (1 939) and Hedge (1 965; sect. Neurotmpis= section Thlaspi). Species belonging to Neurotropis as traditionally delimited (e.g. T. p@oliatum, T. orbiculatum, ir: szowitsianum: annuals; T. bulbosum: perennial) are characterized by broadly winged fruits. Judged from differences in seed coat epidermis, Meyer (1979) recognized two lineages, i.e. Microthlaspi and Nmrotropis (Table 1). irhlaspi bulbosum is characterized by seed coat features different from those in Neurotropis and Microthlaspi and was treated by Meyer as a distinct genus, i.e. Raparia, suggested to be closely related to Noccaea (see above). The ITS-phylogeny (Fig. 1) is generally supportive of Meyer’s concept. Ihlaspi bulbosum is nested within the Noccaea clade. Microthlaspi core group (M. granatense not included) and Neurotmpis seem to represent separate lineages. Neurotropis is found in a clade along with Vania and Microthlaspigranatense. This clade is only weakly supported by a bootstrap value of 41 ‘30and a decay value of 1. Therefore, no firm conclusion can be drawn about phylogenetic relationship of the latter clade to rembining Ihlaspi s. 1. taxa. Comparable to the problems in the classification,of Ihlaspi s. 1. species with acute horns at fruit apex, lack of fruit wings was pyeviously taken as evidence to combine Thlaspi s.1. species in section Apteygium (e.g. Schulz, 1936; Hedge, 1965). Schulz (1936) and Hedge (1965) placed 7: cepaaifolium subsp. rotund@ium and T. kurdicum in Ihlaspi section Apteygium (=Noccaea section Noccaea s m u Meyer; see Table 1). Based on the structure of the seed coat, Meyer (1973, 1979),however, classified T. kurdicum along with two newly recognized species (Vania campylophylla F.K. Meyer; l? puluinatu F.K. Meyer) as a distinct lineage, i.e. Vania F.K. Meyer, whereas T. cepaafolium subsp. rotundijilium was retained in Noccaea sect. Noccaea (Table 1). Members of Vania are xeromorphic cushion-shaped plants from altitudes between 300HOOO m as. 1. in SE Anatolia. All three species have seed coats different from those in Noccaea, and Vania species are characterized by apiculate anthers never observed in Noccaea (Meyer, 1979, 1991). Our molecular data are in complete agreement with Meyer’s concept and they would strongly support the separate status of Vania whereas T. cepaafolium subsp. rotundijilium is well nested in the Noccaea clade (Fig. 1). The molecular phylogeny would also suggest closer relationships of Vania to Nmrotropis than to Noccaea. The main objective of the current study was to test the hypothesis of Meyer (1979) that fruit form is convergent among Ihlaspi s. 1. lineages. The Thlaspi s. 1. segregates of Meyer can be recognized in the ITS-phylogeny and they include species which are morphologically diverse in fruit shape (Thlaspi s.s.: ?: aroense, 7: ceratocarpum, T. alliaceum; Ihlaspiceras: 7: oxyceras, 7: elegans, Noccaea: ir: cepae@cum subsp. rotundijilium, T. montanum; Table 1, Fig. 1). Furthermore, species characterized by the same fruit shape type were distributed among different lineages (Table 1, Fig. 1). For instance, fruits with prominent horns at the apex are found in Ihlaspi s. s. (T. ceratocarpum) and Thlaspiceras (‘I:oqceras). Uniformly broad-winged fruits are Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 zyxw zyxwvu zyxwvut zyxwvutsr zy zyxwvu 192 zyxwvu zyxwvut zyxwvut zyxwvu K. MUMMENHOFF ETAL. typical of 7: amense (Thlaspis. s.), 7: bulbosum (Noccaea/Raparia) and .h4eurotropis.Unwinged fruits are found in Noccaea section Noccaea (T cepmifolium subsp. rotundfolium) and Vania. Therefore our results offer clear evidence of convergence in fruit characters previously used for sectional classification in Thlaspi s. 1. 1 137/ 1-3). REFERENCES Al-Shehbaz IA. 1986. The genera of Lepidieae (Cruciferae; Brassicaceae)in the southeastern United States. J o u m l ofthe Arnold Arboretum 67: 265-31 1. Avetisian VE. 1983. The system of the family Brassicaceae. Botaniceshj &ma1 68: 1297-1305. Baldwin BG, Sanderson MJ, Porter JM,Wojciechowski MF, Campbell S, Donoghue MJ. 1995. The ITS region of nuclear ribosomal DNA a valuable source of evidence on angiosperm phylogeny. Annals ofthe Mirsouri Botanical Garden 82: 247-277. Baum DAYSytsma KJ, Hoch P. 1994. A phylogeqetic analysis of Epilobium (Onagraceae) based on nuclear ribosomal DNA sequences. Systematic Botuny 19: 363-388. Boissier E. 1849. Dqnoses plantarurn orientalium novarum ser. 1,8. Paris. Bush NA. 1939. T h h p i ; Carpoeceras. In: Komarov VL, Bush NA, eds. Flora ofthe U.S.S.R. i%l VIIZ. Moscow: Izdatel'stvo Akademii Nauk SSSR. (Engliih translation: Koenigstein: Koeltz Scientific Books (1985),432442. Clapham AR. 1964. 7 h h p i . In: Tutin TG, Heywood VH, Burges NA, Valentine DH, Walters SM, Webb DA, eds. Flora Eumpea. El. I , Cambridge: Cambridge University Press, 318-322. De Candolle HP. 1821. &pi vegetabilis gskma naturale. 2. Paris: Treuttel et Wiirz. Donoghue MJ, Olmstead G, SmithJF, PalmerJD. 1992. Phylogenetic relationships of Dipsacales based on rbcL sequences. Annals ofthe Missouri Botanical Garden 79 333-345. Doyle JJ, Doyle JL.1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytuchemical Bulletin 19: 11-15. Dvorak F. 1971. O n the evolutionary relationships of the family Brassicaceae. Feddes Repertorium 82: 357-372. Dvorkkova M. 1968. Zur Nomenklatur einiger Taxa aus dem Formenkreis van lhlaspi alpestre (L.) L. Folia Geobotunua et P&.otaronomica 3: 341 -343. Eigner J. 1973. Zur Stempel- und Fruchtentwicklungausgewahlter Brassicaceae ( = Cruciferae) unter neueren Gesichtspunkten der Bliitenmorphologie und der Systematik. Beitree Cur Biologie der PJIanZen 4 9 359429. Endress PK. 1992. Evolution and floral diversity: the phylogenetic surrounding of Arabidopsis and Antirrhinum. IntnnatonalJoumal of Plant Sciences 153: 10G122. Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39 783-791. Greuter W, Burdet HM, Long G. 1986. Med-Checklist. A m'tical inventoty o f vascular plants ofthe circumtnediterrallean countries. BE. 3. Gentve: Consexvatoire et Jardin botaniques de Genkve. Hedge IC. 1965. Thhpi. In: Davis PH, Cullen I, Coode MJE, eds. Flora ofTur@ Vol. 1. Edinburgh University Press, 330-341. Hedge IC. 1976. A systematic and geographical survey of the old world Cruciferae. In: Vaughan JG, MacLeod AJ, Jones MB, eds. The biologv and chemirtry ofthe Crucferae. London: Academic Press, 1-35. Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 We would like to thank those persons or institutions for kindly providing plant material, U. Coja for her valuable technical help and one anonymous reviewer for useful comments on the manuscript. This work was supported by a grant of the German Research Foundation (Deutsche Forschungsgemeinschaft; Mummenhoff zyxwvu zyxwv zyxwv zyxwvuts zyxw zyxwvut zyxwv zyxw zyxwvuts zyxwvutsrq zyx zyxwvuts zyxwvutsr ITS DNA PHYLOGENY OF THLASPZ 193 Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 Hedge IC. 1988 Thhpi. In: Davis PH, Mill RR, Tan K, eds. Flora of Turkey El. 10 (Supplement). Edinburgh: Edinburgh University Press, 3947. Hillis DM, Huelsenbeck JP. 1992. Signal, noise and reliability in molecular phylogenetic analyses. j o u m l ofHeredi9 83: 189-195. Kluge AG, Farris JS. 1969. Quantitative phylogenetics and the evolution of anurans. Systematic <OO~OQ 1 8 1-32. Koch M, Mummenhoff K, Zunk K. 1993. Isoelektrische Fokussierung der Untereinheiten der Rubisco in 7 h h p i (Brassicaceae): Weitere Hinweise auf eine Formengattung. Feddes Repertonurn 104 37 1-381. Kron KAYKing JM. 1996. Cladistic relationships of Kalmia, Laophyllum, and Loiseleuria (Phyllodoceae, Ericaceae) based on rbcL and nrITS data. Systematic Botany 21: 17-29. Meyer FK. 1973. Conspectus der “X’dmpz”Arten Europas, A f h und Vorderasiens. Feddes Repertohm 84: 449470. Meyer FK. 1979. Kritische Revision der “liilmp?’ Arten Europas, Mrikas und Vorderasiens. Feddes R@e?torium 90: 129-154. Meyer FK. 1991. Seed-coat anatomy as a character for a new classification of 7hla.s$. Flora et Egetatio Mundi 9 9-15. Mummenhoff K, Zunk K. 1991. Should n h p i (Brassicaceae)be split? Preliminary evidence from isoelectric focusing analysis of Rubisco. Tmon 4 0 427434. Mummenhoff K, Koch M. 1994. Chloroplast DNA restriction site variation and phylogenetic relationships in the genus Thlmpi sensu lato (Brassicaceae).Systematic Botany 19: 73-88. Mummenhoff K, Franzke A, Koch M. 1997. Molecular phylogenetics of Thlmpi s. 1. (Brassicaceae) based on chloroplast DNA restriction site variation and sequences of the internal transcribed spacers of nuclear ribosomal DNA. Canadian Journal of Botany 75: 469482. Rathgeber J, Capesius I. 1989. Nucleotide sequence of the 18s-25s spacer region from mustard DNA. Nucleic A& Research 17: 7522. Sanger F, Nicklen S, Coulsen AR. 1977. DNA sequencing with chain-terminating inhibitors. hceedings ofthi? National Academy ofS&nces ofthe USA 7 4 5t.63-5467. Schulz OE. 1936 7hh$. In: Engler A, Prantl K, eds. Die nptiirlichen lyEanzmfamilim, Cmcferu, 17 B. Leipzig: W. Engelmann, 444-445. Swofford DL, Olsen GJ. 1990. Phylogeny reconstruction. In: Hillis DM, Moritz M, eds. Molecular Systematics. Sunderland Sinauer, 41 1-501. Swofford DL. 1993 Phylogmetic Am$& Using Parsimony version 3.1.1. Illinois Natural History Survey, Champaign. Sytsrna KJ. 1990. DNA and morphology: inference of plant phylogeny. Trends in Ecology and Evolution 5: 104-110. Vaughan JG, Whitehouse JM. 1971. Seed structure and the taxonomy of the Cruciferae. Botanical 30~n~ll ofthe Linnean Socie& 64: 383-409. Zunk K, Mummenhoff K, Koch My Hurka H. 1996. Phylogenetic relationships of 7lhfl‘ s. 1. (subtribe Thlaspidinae, Lepidieae) and allied genera based upon chloroplast DNA restriction-site variation. Tho?ztical and Applied Genetics 92: 375-381. zyxwvu zyxw zyxwvu zyxwvutsrqpon zyxwv zyxwvuts zyxwvu zyxwvuts zyxwvu zyxwvutsrqp K. MUMMENHOFF E7AL. 194 APPENDIX 1 Species of n h p i s. 1. analysed for ITS sequence variation Locality of sampIing/sourceb 'Taxed & abbreviation subsp. 1~aerUleSCmc subsp. calamznare (Lej.) Dvorik. 7: cepanfolium (M'ulfen) Koch subsp. mtundiblia iL.I Greuter & Burdet 7: ceratocarpum (Pa~~as) hfurray 7: elegatu Boiss. 7: granatense Boiss. & Reuter _ I ALL ARV BUL CAE **Germany, DUSS 1986 219 Germany, Osnabruck Koch 591 **Switzerland, Bot.Gard. St. Gallen 1989 258 Germany, St. Jost Koch 31292 CAL ROT Germany, Hagen a.T.W. Italy, Monte Sass Rigas Koch 1291 Gieshoidt s.n CER ELE GRAl GRA2 KUR **GCCM *Turkey, Iqel, B Morocco, Great Atlas GCCM Spain, Sierra de Baza *Turkey, Van Gevas MAC MON NAT CAM **Germany, Kiel Germany, Muggendorf Turkey, Antalya, Agva Deresi *Georgia, Borshomi *Turkey, Adana, B Germany, Doggendorf Germany, Bad Laer France, St. Laurent-en-Rayan France, Combe de la Chalanqon *Armenia, Kirovakan *Turkey, Van, Satak 1538 70 106/95-94 1112 67 Galland s.n. Davis & Polunin 22806 1989 395 Koch 190 Gerstberger s.n. Roemer s.n. 106 95 98 Koch 1891 Koch 1991 Waser s.n. Waser s.n. Buhl 11383 Davis & Polunin 23132 SAT VIR Germany, MB Mexico, Carrizal Chi0 \ 'r h r d i w m Hedge 7. matranthum (Lipsky) N. Bus 7: montanum L. 7: n a b l w Boiss. 7: orbiculatum DC. 7: o.ycerm (Boiss.) Hedge 7: perrliatum .I ORB OXY Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 7: alliacerim L. 7: a m m e L. 7: bulboswn Boiss. 7: ~nerulescensJ. & C. Presl Accession' zyxwvuts PEN PEN PES 1 PES2 7: sZoaitianum Boiss. &in cam,?p!ophylla F.K. Meyer szo OUTGROU'S Lepidium satimm L. L. ui@imm L. 1983 Bosbach s.n. Xomenclature of species follows Greuter el al. (1 986), Dvorakova (1 968) for ?: c m l e s c m , and Meyer (1 973) for hnia cam~lDphYlhand A4inothlaspi species (M. granakme, M . natoluum, M. p@oliatum, see Table I). For better understanding, the common name 7hhpi (instead of :MinOtlrhpi) has been retained in this appendix. * =Herbarium specimens used as a source of material for DNA isolation. Names of herbaria are indicated by their acronyms ** =Seed samples from cultivated plants. All other seed samples were collected directly from wild populations and plants were grown up in the greenhouse for DNA analysis. GCCM = Gomez-Campo collection Madrid. ' Accessiodvoucher number of the institution supplying the seed material or collectors with their numbers. zyxwvut zyxwvu zyx zyxwv zyxw zyxwv zyx ITS DNA PHYLOGENY OF 7HUSPZ 195 APPENDIX 2 Aligned DNA sequences of the internal transcribed spacer regions (ITS) from iT;I!@i s. 1. taxa and outgroup species, Lepidium sativum (SAT) and L. uiginicum (VIR) SZO GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR Gaps ARV CER ALL OXY ELE CAM KURD ORB szo GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR JITS-1 TCGTAACCTGTTAAAAACAGAACGACCCGAGAACAA--TCGATCATCACT TCGTAACCTGTTAAAAACAGAACGACCCGAGAACAA--TCGATCATCACT TCATAACCTGTCCAAAACAGAATGACCCGAGAACAA--TCGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTAATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTAATXATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCGAAACAGAATGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTSNAAAACAGAATGACCCTAGAAGGCAGTCGATCATCACT TCGATACCTGTCAAAAACAGAATGACCCGAGAACGA--TTGATCATTACT TCGATACCTGTCCAAAACAGAATGACCCGAGAACGA--TTCATCATCACT TCGATACCTGTCCAAAACAGAATGACCCGAGAACGAy-TTCATCATCACT TCGATACCTGTCCGAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCGAAACAGAACGACCCGAGAACG~--TTGATCATCACT TCGATACCTGTCCGAAACAGAACGACCCGAGAACGA--TTGATCATCACT TGGATACCTGTCCGAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACY TCGATACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGAGAACGAC-TTGACCATCACT TCGTTACCTGTCCAAAACAGAACGACCCGAGAACGA--TTGATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGCGAACCA--ACTATCATCACT TCGATACCTGTCCAAAACAGAACGACCCGCGAACCA--ACTATCATCACT ** *** * * * *** 1 2 3 CTCGGTGGGCC-AGTTTCTTAAATGATCT-TGTGCCT-GCCGATTCCGTG CTCGGTGGGCC-AGTTTCTTAAATGATCT-TGTGCCT-GCCGATTCCGTG CTCGGTGGGCC-GGTTTCATAGCTGATTC-CGTGCCT-GCTGATTCCGTG CTCAGCGGGCC-GGTTTCTTAGCTGATTC-CGTGATC-GCTGATTCCGTG CTCAGCGGGCC-GGTTTCTTAGCAGATTC-TGTGCCT-GCTGATTCCTTG CTCGGTGGGCC-GGTTTCCTAGCCGATTC-TGTGCCT-GCTGATTCTGTG CTCGGCGGGCC-GGTTTCCTAGCCGATTC-TGTGCCC-GCTGATTCTGTG CTCGGCGGGCC-GGTATCTTAATTGATCT-CGTGCCT-GCTGATTTCGTG CTCGGTAGGCC-GGTTTCTTAATTGATCT-CGTGCCT-GCTGATTTCGTG CTCAACGGGCC-AGTTTCTTAGCCGATCC-TGTGCCC-GCTGATTCCTTG CTCAACGGGCC-AGTTTCTTAGCCGATCC-TGTGCCC-GCTGATTCCTTG CTCGGCGGGCC-GGTTTCTTAGCGGATCC-CGTGCCC-GCTGATTCCGTG CTCGGCGGGCC-GGTTTCTTAGCGGATCC-CGTGCCC-GCTGATTCCGTG CTCGGCGGGCC-GGTTTCTTAGCGGATCC-CGTGCCC-GCTGATTCCGTG CTCGGCGGGCC-GGTTTCTTTGCAGATCT-CGTGCCC-GCTGATTCCGTG CTCAGCGGGCC-GGTTTCTTAGCCGATTC-TGTGCCC-GCTGATTCCGTG CTCAGCGGGGC-GGTTTCTTAGCCGATTC-TGTGCCC-GCTGATTCCGTG GTCGGCTGGGGCCGTTTCTTAGCCGCTTC-CGTGCCC-GGCGATTCCGTG CTCAGCGGGCC-GGTTTCTTAGCCGATTC-TGTGCCC-GCTGGTTCCGTG CTCGGCGGGCC-GGTTTCTTATCCGATTCCTGTGCCCTGCCGATTCCGTG CTCGGCGGGCCTGGTTTCTTAGCCGATTC-TGTGCCC-GCCGATTCCATG TGCGGTGGGCC-GGTTTCTTAGCAGATCC-CGTGTCC-GCCGAATCCTTG TGCGGTGGGCC-GGTTTCCTAGCAGATCC-CGTGTCC-TCCGAATCCTTG ** * * * * * * *** ** * * * 50 * * *** 100 Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 ARV CER ALL OXY ELE CAM KURD ORB 196 zyxwvu zyxwvu zyxwvu zyxwvu zyxwvutsrq zyxwvutsrqp K.MUMMENHOFF ET AL. 4 Gaps ALL OXY ELE CAM KURD ORB SZO GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT 150 GTTTCG-CGTTCCGTTCC---GAACGGGGAG-ATCT---CCCGGATC GTTGCG-CGTATTGTTCC---GAACGGGAG-ATC--TCT---CCCGGACC VIR ** *** ** * Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 GTTTCG-CGTACGATTCTCATCAAGGTATATATATATAT----CTTGGTT GTTTCG-CGTAGGATTCTCATCAAGGTATATATATATATATATCTTGGTT GTTTTG-CGTAAGGTCCTCATCAAGGTA--------TATATACCTAGGTA GTTTTG-CGAGTGGTTCTTTTCGAG------ATA--TTTTAATCTTGATT GTTTTG-CGAGTGGTTCTTTCAAGA--------TTTTKTCAATCATGATT GTTTTG-CGTATGGTTCCCATCAGA---------TTTTTACATCTTGATA GTTTTG-CGTATGGTTCCCATTAGA---------TTTTTACATCTTGATA GTTAAG-CGTATGGTTACC------------------------------GTTAAG-CGTATGGTTAC-------------------------------GTTTTG-CGTATGGTTCCCATCAAG------ATATTTCTGTATCTTGATA GTTTTG-CGTATGGTTCCCATCAAG------ATATTTCTGTATCTTGATA GTTTTG-CGAGTGGTTCCTATCAGG------ATTTATTTTATCCTTGATT GTTTTG-CGCGAGGCTCCTTTCAGT------GTATGTTTTTATCCTGATT GTTTTG-CGCGTGGCTCCTTTCGGT------ATATGTTTTTATCCTGATT GTTTTGCTAAGTGGCTCCTGTCCGG----ATATATATTTTAATACTGATT GTTTTG-CGAGTGGTTC-TATCAAG------AT---TTTTAATCCTGATT GTTTTG-CGAGTGGTTC-TATCAAG------AT---TTTTAATCCTGATT GTTTTG-CKAGTGGTTC-TATCGAG------AT---TWTTAATCCTGATT GTTTTG-CGAGTGGTTC-TATCAAG------AT---TTTTAATCCTGATT GTTTTGTCGAGTGGTTC-TATCAAG------AT---TTTTAATCCTGATT GTTTTG-CGAGTGGTTC-TATCAAG------AT---TTTTAATCCTGATT ARV CER zyxwvutsr Gaps ARV CER ALL OXY ELE CAM KURD ORB szo GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR 5 6 TGATCATGCGTGTAGCTTCCGGTTAT-CACAAAACCCCGGCACGAAAAGT TGATCATGC~TGTAGCTTCCGGTTAT-CACAAAACCCCGGCACGAAAAGT GGATCATGCGCTTAGCTTCCGGATAT-CACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTCGGATATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTWTCGGAAATTCACAAAACCCCGGCACGAAAAGT GGTCTATGCGCTTAGC-TACGGAAATTCACAAAACCCCGGCACGAAAAGT GGTCTATGCGCTTAGC-CACGGAAATTCACAAAACCCCGGCACGAAAAGT --ACTATGCGCTTAGCTTCCGAAARTTCACAAAACCCCGGCACGAAAAGT -AACTATGTGCTTAGCTTCCGWAAATTCACAAAACCCCGGCACGAAAAGT GGACTATGCGTTTAGCTTCTGGAAATTCACAAAACCCCGGCACGAAAAGT GGACTATGCGTTTAGCTTCTGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTCCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGTGCTCAGCTTCCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTACGTGCTCAGCCTCCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCCATGTGCTTAGCTTCCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTTGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTTGGAA?+TTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTCGGAAATTCACAAAACCCCGGCACGAAAAGT GGGCTATGAGCTTAGCTTTCGGAAATTCACAAAACCACGGCACGAAAAGT GGGCTATCAGCTTAGCTTTCGGAAATTCACAAAACCCCGGCACGAAAAGT GGTC-GTGCGCGTAGCTGATGGATA-TCACAACAACACGGCACGAAAAGT GGTC-GTGCGCGTAGCTGATGGATA-TCACAACAACACGGCACGAAAAGT 200 zyxwvutsrqpon **** * *** *** *** * * * zyxwvut zyxwvu zyxw zyxwvutsrq ITS DNA PHYLOGENY OF THUSPI Gaps ARV CER ALL OXY ELE CAM KURD ORB 197 I 8 9 GTCAAGGAACATGCAACTAAA-CAGCCAGCGTTT-GCCTTCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCAGCGTTT-GCCTTCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGCGTTC-GCCGACCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCGCCCCAGAAATG GTCAAGGAACATGCAACTAAG-CAGTCTGC-TTCCGCCGCCCCGGAAATG GTCAAGGAATATGAAACTTAA-CAGTCGGT-TTCCGCCTTCCCGGAGACG GTCAAGGAATATGAAACTTAA-CAGTCGGT-TTCCGCCTTCCCGGAGACG 250 zyxwvutsrqp GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR Gaps ARV CER ALL OXY ELE CAM KURD ORB szo GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR GTCAAGGAACATGCAACTACAGCCTGC-TTCAGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAAACAFCCTGC-TTCTGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCTGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCTGCCTCCCCGGAGACG GTCAAGGAACATGCAACTGAA-CAGCCTGC-TTCCGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCTCCCCGGAGACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCTGCCGCCCCGGAAACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCTGC,CGCCCCGGAAACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCGCCCCGGAAACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCTGCCGCCCCGGAAACG GTCAAGGAACATGAAACTAAA-CAGCCTGC-TTCCGCCGCCCTGGAAACG GTCAAGGAACATGCAACTAAA-CAGCCTGC-TTCCGCCGCCCCGGAAACG GTCAAGGAACATGCAACCGAA-CGGCCAGTGTTC-GCCTTCCCGGAGACG GTCAAGGAACATGCAACCGAA-CGGCCAGCGTTC-GCCTTCCCGGAGACG * * Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 szo zyxwvuts ** * * * * ** ** * * 1 1 1 0 1 2 LITS-2 GTGTTTGCGTGAAACGCTTT-GCTGCAATTTTAAAGTCTATCGTCGTCCCC GTGTTTGCGTGA-ACGCTGT-GCTGCAATTTAAAGTCTATCGTCGTCCCC GTGTTTGCGCGG-ACGTTGT-GCTGCAATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGG-ATGCTGT-GCTGCGATCTAAAGTCTATCGTKGKCCCC GTGAGTGTGCGG-ATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGTGCGG-ATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGCGCGG-ATGCTGT-GCTGCAATCTAAAGTCTATCGTCGTCCCC GTG-GTGCGCGG-ATGCAGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTG-GTGCGCGG-ATGCATT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGTGCGGGATGCTCA-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGTGCGGGATGCTGA-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGTGCGGGATGCTCA-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGTGTGTGCGGGATGCTGC-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGAAGCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGAAGCTGCGATCTAAAGTCTATCGTCGTCCCC GTAAGTGTGCGGGATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGA-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGAGTGTGCGGGATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC 300 zyxwvutsr GTGAGTGTGCGGGATGCTGT-GCT-CGATCTAAAGTCTATCGTCGTCCCC GTGAGAGCGCGG-ATGCTGT-GCTGCGATCTAAAGTCTATCGTCGTCCCC GTGCAAGCGCGA-ATGCTGT-GCTGCGATCTAAAGTCTATXGTCGTTCCC * * * * * * * *** * * 198 zyxwvu zyxwv zyxwvutsrqpon K. MUMMENHOW ETAL.. zyxwvutsrqp Gaps L 3 ARV CER ALL OXY ELE CAM KURD ORB SZO GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR ** * * * * * ARV CER ALL OXY ELE CAM KURD ORB GRAl GRA2 PEN PES2 PES1 NAT CAE CAL MON ROT MAC BUL SAT VIR * zyxwvutsr zyxwvutsrqpo Gaps szo * 350 Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 ---C-ATCCTCTTAAGGATACGGGACGGAAGCTGGTCTCCCGTGTTTTAC ---CCATCCTCTTAADDATATGGGACGGAAGCTGGTCTCCCGTGTTTTAC ---CCATCCTCTTGAGGATATGGG-CGGAAGCTGGTCTCCCGTGTTGTAC AA----TCCTCT-AAGGATAATGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCT-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCT-AAAAGGRTAATGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCT-AAAAGGATAAAGGACGGAAACTGGTCTCCCGTGTGTTAC _--_ CATCCTTT-AAGGATAATGGACGGAAACTGGTCTCCCGTGTGTTAC _ - _CATCCTTT-AAGGATAATGGACGGAAACTGGTCTCCCGTGTGTTAC ---CCATCCTCT-AAGGATGCAGGACGGAAACTGGTCTCCCGTGTGTTAC ---CCATCCTCT-AAGGATGCAGGACGGAAACTGGTCTCCCGTGTGTTAC TA----TCCTCT-AAGGATACAGGACGGAAACTGGTCTCCCGTGTGTTAC TATCC-TCCTCT-AAGGATACAGGACGGAAACTGGTCTCCCGTGTGTTAC TATCC-TCCTCT-AAGGATACAGGACGGAAACTGGTCTCCCGTGTGTTAC TATCC-TCCTCT-AAGGATACAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCT-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCT-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCT-AAGGGTAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCT-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCATCT-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC AA----TCCTCA-AAGGATAGAGGACGGAAACTGGTCTCCCGTGTGTTAC CTCACGAATTTTCACGAGTGTGGGACGGAAGCTGGTCTCCCGTGTGTTAC CTCAVAAAATTATGCGAGTGCGGGACGGAAGCTGGTCTCCCGTGTGTTAC 1 1 1 4 5 6 CGAATGC-GG-TGGCCAAAATCTGAGCTAAGGACGCCAGGAGTGTCTCGA CGAATGC-GGTTGGCTAAAATCTGAGCTAAGGACGCCAGGAGCGTCTCGA CGAACGC-GGTTGGCCAAAATCCGAGCTTAAGACGCCAAGAACGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCTGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCT-GAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCGGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCGGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCTGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGTCTGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCGGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCGGGAGCGTCTTGA CGTACGC-GGTTGGCCAAAATCCGAGCTGAGGACGCCGGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCGGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCGGGAGCGTCTCGA CGTACGCLGGTTGGCCAAAATCCGAGCTAAGGACGCCGGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCTGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCTGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCTGGAGCGTCCCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCTGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGACGCCTGGAGCGTCTCGA CGTACGC-GGTTGGCCAAAATCCGAGCTAAGGATGCCTGGAGCGTCTCGA CGCACGCGTTGTGACCAAAATCCGAGCTGAGGATGTTTGGAGCGTCCCGA CGCACGCAGGTTGGCCAAAATCTGAGCTGAGGATGCTGGGAGCGTCCCGA * * * * * *** ** 400 zyxwvu zyxw zyxwv zyx zyxw ITS DNA PHYLOGENY OF THUSPl Gaps szo GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR Gaps ARV CER ALL OXY ELE CAM KURD ORB szo GRAl GRA2 PEN PES2 PESl NAT CAE CAL MON ROT MAC BUL SAT VIR 1 I CATGCGGTGGTGAATTCAAGCCTCTTTAGTTTGTCGGCCGCTCT-TGTCT CATGCGGTGGTGAATTCAAGCCTCTTTAGTTTGTCGAACGCTCT-TGTCT CATGCGGTGGTGAATTCAAGCCTCTTCATTTTGTCGGTCGCTCTTTGTCC CATGCGGTGGTGAATTCAAGCCTCTTGATATTGTTGAACGCTCC-TGTTC CATGCGGTGGTGAATTCAAGCCTCTTGTTATTGTTGAAGCCTCT-TGTTC CATGCGGTGGTGAATTCAAGCCTCTTCATATTGTTGAACGCTCCCTGTCT CATGCGGTGGTGAATTCAAGCCTCTTCATATTGTTGAACGCTCC-TGTCT CATGCGGTGGTGAATAAAAGCATCTTCATATTGTTGAACGCTTCCTGTCC CATGCGGTGGTGAATAAAAGCATCTTCATATTGTTGAACGCTTCCTGTCC CATGCGGTGGTGAATTCAAGCCTCTTGATATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCTTGATATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCGTCATACTGTCGAACGCTCC-CGTCC CATGCGGTGGTGAATTCAAGCCTCTTCATACTGTCGAACGCTCT-CGTCC CATGCGGTGGTGAATTCAAGCCTCTTCATACTGTCGAACGCTCT-CGTCC CATGCGGTGGTGAATTCAAGCCTCGTCATACCGTCGAACGCTCT-CGTCC CATGCGGTGGTGAATTCAAGCCTCTTGGTATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCTTGGTATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCTTGATATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCTTGGTATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATATAAGCCTCTTGGTATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGAATTCAAGCCTCTTGGTATTGTTGAACGCTCC-TGTCC CATGCGGTGGTGATCTAAAGCCTCTTCATATTGCCGGTCGCTCC-TGTCC CATGCGGTGGTGATCTAAAGCCTCTTCATATTGCCGGTCGCTCC-TGTC- **** * * ***** * * ** 1 1 22 2 8 9 01 2 GGAAGC-TCTTGATGACCCAAAGTCCTCAAC GGAAGC-TCTTGATGACCCAAAGTCCTCAAC GAAAGC-TCTTGATGACCCAAAGTTCTCAAC G-AAGC-TATAGATGACCCAAAGTTCTCAAC G-AAGCCTTTAGATGACCCAAAGT-CTCAWC A-AAGC-TTTAGATGACCCAA-GTCCTCAAC A-AAGC-TTTAGATGACCCAAAGTCCTCAAT G-AAGC-TTCAGATGACCCAAA-TCCTCAAT G-AAGC-TTTAGATGACCCAAA-TCCTCAGT G-AAGC-TTTAGATGACCCAAAGTCCTCAAC G-AAGC-TTTAGATGACCCAAAGTCCTCAAC G-AAGC-TTTAGATGACCCAAAGTCCTCAAC G-AAGC-TTTAGATGACCCAATGTCCTCAAC G-AAGC-TTTAGATGACCCAATGTCCTCAAC G-AAGC-TTTAGATGACCCAAAGTCCTCAAC G-AAGC-TTAAGATGACCCAAAGACCTCAAC G-AAGC-TTAAGATGACCCAAAGACCTCAAC G-AAGC-TTAAGATGACCCAAAGACCTCAAC G-AAGC-TTAAGATGACCCAAAGACCTCAAC G-AAGC-TTAAGATGACCCAAAGACCTCAAC G-AAGC-TTTAGATGACCCAAAGATCTCAAC GTAAGC-TCTCGTTGACCCAAAGTCCTCAAA ATAAGC-TCTCGTTGACCCAATGTCATCAAA ** * * * 450 Downloaded from https://academic.oup.com/botlinnean/article-abstract/125/3/183/2630964 by guest on 14 June 2020 ARV CER ALL OXY ELE CAM KURD ORB 199 zyx 481 zyxwvutsr zyxwv ** *** * * ** * NoNOet: Vertical columns represent nucleotide positions, numbered consecutively 1-48 1 (5’-3’), within the nuclear ribosomal DNA internal transcribed spacers (ITS-1 and ITS-2). The beginning of the ITS-I region (positions 1-88), at position 1, and the beginning of the ITS-2 region (positions 289-481), at position 289, are indicated by arrows. Horizontal rows are individual DNA sequences. Gaps (=hyphens) are numbered (1-22) above and scored as additional binary @resence/absence)character. See Appendix 1 for taxon abbreviation. Sequence symbols: A, C, G, T= &TI’, dCTP, dGTP, dTTP, respectively; R =A or G; W = A or T, S =C or G; Y = C or T; K = G or T. Asterisks (*) mark variable nucleotide sites used in parsimony analysis.