Systematics of Amaryllidaceae based on cladistic analysis of plastid sequence data

Alan W. Meerow; Michael F. Fay; Charles L Guy; Qin‐Bao Li; Faridah Q Zaman; Mark W. Chase

Cladistic analyses of plastid DNA sequences rbcL and trnL-F are presented separately and combined for 48 genera of Amaryllidaceae and 29 genera of related asparagalean families. The combined analysis is the most highly resolved of the three and provides good support for the monophyly of Amaryllidaceae and indicates Agapanthaceae as its sister family. Alliaceae are in turn sister to the

American Journal of Botany 86(9): 1325–1345. 1999. SYSTEMATICS CLADISTIC AMARYLLIDACEAE BASED ON ANALYSIS OF PLASTID RBCL AND TRNL-F OF SEQUENCE DATA1 ALAN W. MEEROW,2,3 MICHAEL F. FAY,4 CHARLES L. GUY,5 QIN-BAO LI,5 FARIDAH Q. ZAMAN,4 AND MARK W. CHASE4 3 University of Florida, Fort Lauderdale Research and Education Center, 3205 College Avenue, Fort Lauderdale, Florida 33314; 4Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3DS, UK; 5University of Florida, Department of Environmental Horticulture, 1545 Fifield Hall, Gainesville, Florida 32611 Cladistic analyses of plastid DNA sequences rbcL and trnL-F are presented separately and combined for 48 genera of Amaryllidaceae and 29 genera of related asparagalean families. The combined analysis is the most highly resolved of the three and provides good support for the monophyly of Amaryllidaceae and indicates Agapanthaceae as its sister family. Alliaceae are in turn sister to the Amaryllidaceae/Agapanthaceae clade. The origins of the family appear to be western Gondwanaland (Africa), and infrafamilial relationships are resolved along biogeographic lines. Tribe Amaryllideae, primarily South African, is sister to the rest of Amaryllidaceae; this tribe is supported by numerous morphological synapomorphies as well. The remaining two African tribes of the family, Haemantheae and Cyrtantheae, are well supported, but their position relative to the Australasian Calostemmateae and a large clade comprising the Eurasian and American genera, is not yet clear. The Eurasian and American elements of the family are each monophyletic sister clades. Internal resolution of the Eurasian clade only partially supports currently accepted tribal concepts, and few conclusions can be drawn on the relationships of the genera based on these data. A monophyletic Lycorideae (Central and East Asian) is weakly supported. Galanthus and Leucojum (Galantheae pro parte) are supported as sister genera by the bootstrap. The American clade shows a higher degree of internal resolution. Hippeastreae (minus Griffinia and Worsleya) are well supported, and Zephyranthinae are resolved as a distinct subtribe. An Andean clade marked by a chromosome number of 2n 5 46 (and derivatives thereof) is resolved with weak support. The plastid DNA phylogenies are discussed in the context of biogeography and character evolution in the family. Key words: Amaryllidaceae; cladistic analysis; molecular systematics; moncotyledons; phylogeny; plastid DNA. The Amaryllidaceae J. St.-Hil., a cosmopolitan (predominantly pantropical) family of petaloid monocots, represent one of the elements of the Linnaean Hexandria monogynia (Linnaeus, 1753), the 51 genera of which have been variously classified since as liliaceous or amaryllidaceous. This basic dichotomy represents the generally uncertain phylogenetic placement of many petaloid monocots until the past two decades. Seven of the 51 genera that Linneaus placed in Hexandria monogynia have since been included within a common taxonomic unit, as section Narcissi (Adanson, 1763; de Jussieu, 1789), family Amaryllideae (Jaume-St.-Hilaire, 1805; Brown, 1810), order Amaryllidaceae (Lindley, 1836; Herbert, 1837), tribe Amarylleae (Bentham and Hooker, 1883), suborder Amarylleae (Baker, 1888), subfamily Amaryllidoideae (Pax, 1888); family Amaryllidaceae 1 Manuscript received 10 August 1998; revision accepted 14 January 1999. Significant portions of this work were completed during the senior author’s sabbatical leave at the Royal Botanic Gardens, Kew. Some of the sequences were generated at the DNA Sequencing Core of the Interdisciplinary Center for Biotechnology Research at the University of Florida. Financial support was provided by NSF grants DEB-968787 and IBN-9317450 to AWM and CLG, a Research Enhancement Award from the Institute of Food and Agricultural Sciences of the University of Florida, and the Royal Botanic Gardens, Kew. The authors thank David L. Swofford for allowing the use of experimental versions of his PAUP* software. Florida Agricultural Experiment Station Journal Series Number R-03602. 2 Author for correspondence. (Hutchinson, 1934, 1959), and subfamily Amarylloideae (Traub, 1963). Brown (1810) was the first to propose that the genera with superior ovaries be excluded from Amaryllidaceae, a restriction followed faithfully until Hutchinson (1934). Herbert (1837) recognized that the Taccaceae were not allied to Amaryllidaceae, and Pax (1888) formally removed Velloziaceae as part of the family (Herbert’s suborder Xerophyteae). Hutchinson’s (1934, 1959) classification was the first radical recircumscription of Amaryllidaceae since Brown (1810). In defining the unifying character of the family to be ‘‘an umbellate inflorescence subtended by an involucre of one or more spathaceous bracts,’’ he segregated Agavaceae, Hypoxidaceae, and Alstroemeriaceae and added tribes Agapantheae, Allieae, and Gilliesieae (Alliaceae). Takhtajan (1969) recognized Amaryllidaceae in the narrowest sense, and maintained a distinct Alliaceae. Cronquist (1988) and Thorne (1976) included Amaryllidaceae within broad concepts of Liliaceae. Concepts of familial and ordinal limits of the monocotyledons were radically challenged by Huber (1969), who emphasized less conspicuous characters, particularly embryological characters, over gross floral or vegetative morphology. Huber’s work highlighted the heterogeneity present in many traditional monocot families, especially Liliaceae. Much of this work was refined and placed into phylogenetic context by Dahlgren and coworkers (Dahlgren and Clifford, 1982; Dahlgren and Rasmussen, 1983; 1325 1326 AMERICAN JOURNAL Dahlgren, Clifford, and Yeo, 1985). In Dahlgren, Clifford, and Yeo’s (1985) synthesis, Amaryllidaceae and Alliaceae are both recognized as members of the order Asparagales, an order of 31 families that have evolved many traits in parallel with Liliales. One of the most important and consistent characters separating these two orders is the presence of phytomelan in the seed coat of Asparagales (Huber, 1969). To date, phylogenetic analyses of the monocotyledons, based on both morphological and gene sequence matrices, have supported this classification with some amendment (Duvall et al., 1993; Stevenson and Loconte, 1995; Chase et al., 1995a, b), but the precise relationship of Amaryllidaceae to other Asparagales remained elusive until Fay and Chase (1996) used molecular data to argue that Amaryllidaceae, Agapanthaceae, and Alliaceae form a monophyletic group and that together they are related most closely to Hyacinthaceae s.s. and the resurrected family Themidaceae (the former tribe Brodiaeeae of Alliaceae). Despite a lack of consensus on generic limits and tribal delimitations within the Amaryllidaceae, cladistic analysis has only rarely been applied to problems in the family, such as by Nordal and Duncan (1984) for Haemanthus and Scadoxus, two closely related, baccate-fruited African genera, Meerow (1987a, 1989) for Eucrosia and Eucharis and Caliphruria, respectively, and Snijman (1994) and Snijman and Linder (1996) for various taxa of tribe Amaryllideae. Applying phylogenetic studies for the entire family is difficult due to homoplasy for many conspicuous characters within this highly canalized group (Meerow, 1987a, 1989, 1995). This led Meerow (1995) to conclude that ‘‘future reconstruction attempts will greatly benefit from the inclusion of molecular data.’’ The four most recent infrafamilial classifications (Table 1) of Amaryllidaceae are those of Traub (1963), Dahlgren, Clifford, and Yeo (1985), Müller-Doblies and Müller-Doblies (1996), and Meerow and Snijman (1998). Traub’s scheme included Alliaceae, Hemerocallidaceae, and Ixioliriaceae as subfamilies, following Hutchinson (1934, 1959) in part. Within his subfamily Amarylloideae, he erected two informal taxa, ‘‘infrafamilies’’ Amarylloidinae and Pancratioidinae, both of which were polyphyletic (Meerow, 1995). Dahlgren, Clifford, and Yeo (1985) dispensed with any subfamilial classification above the level of tribe, recognizing eight, and treated as Amaryllidaceae only those genera in Traub’s Amarylloideae. Stenomesseae and Eustephieae were combined. Meerow (1995) resurrected Eustephieae from Stenomesseae and suggested that two new tribes may need to be recognized, Calostemmateae and Hymenocallideae. Müller-Doblies and Müller-Doblies (1996) recognized ten tribes (among them Calostemmateae) and 19 subtribes, many of them monogeneric; Meerow and Snijman (1998) recognize 14 tribes, with two subtribes only in one of them (Table 1). Fay and Chase (1996) recircumscribed Amaryllidaceae to include Agapanthus, previously included in Alliaceae, as subfamily Agapanthoideae. This recircumscription was based on phylogenetic analysis of rbcL sequence data, with only four genera of Amaryllidaceae s.s. included in the analysis. All the epigynous genera were treated as Amaryllidoideae. Bootstrap support for this treatment was weak (63%). The sampling within Amaryllidaceae OF BOTANY [Vol. 86 s.s. in Fay and Chase (1996) did not allow sufficient resolution of the generic relationships within the family, and we present here phylogenetic analyses of three plastid DNA sequence data sets for a much wider range of taxa. The phylogenetic application of sequences of rbcL is well documented (e.g., Chase et al., 1993; Olmstead and Palmer, 1994) and has been used to clarify relationships between and within a number of asparagoid families, including Themidaceae (Fay and Chase, 1996), Asphodelaceae (de Bruijn et al., unpublished data), Alliaceae (Fay et al., unpublished data), and Orchidaceae (Cameron et al., 1999). Within Amaryllidaceae, however, levels of resolution obtained within some major clades, particularly those from the Neotropics, were not sufficient to elucidate tribal relationships fully (Fay et al., 1995). For this reason, we chose to combine our rbcL matrix with two for the trnL intron/trnL-F spacer region of noncoding plastid DNA, for which Taberlet et al. (1991) had developed ‘‘universal’’ primers for amplification. Sequences of this region have been used in phylogenetic studies of Crassulaceae (Kim, t’Hart, and Mes, 1996; Mes, Van Brederode and t’Hart, 1996; Mes, Wijers, and t’Hart, 1997), Gentianaceae (Gielly and Taberlet, 1996; Gielly et al., 1996), Paeoniaceae (Sang, Crawford and Stuessy, 1997), Proteaceae (Maguire et al., 1997), Ranunculaceae (Kita, Ueda, and Kadota, 1995), among others, either alone or in combination with other loci. This region of the plastid genome evolves more than three times faster, on average, than rbcL (Gielly and Taberlet, 1994) and can therefore potentially add increased resolution to a phylogeny generated by rbcL sequences. Combining independent character matrices, whether both molecular or molecular and morphological, very often increases the resolution of the ingroup and the bootstrap support of the internal nodes of the phylogenetic trees (Chase et al., 1995b; Olmstead and Sweere, 1994; Rudall et al., 1998; Soltis et al., 1998). In this paper we present the first family-wide phylogenetic analysis of Amaryllidaceae using three plastid DNA sequences, alone and in combination, and comment on the evolutionary and bigeographic implications of the results. MATERIALS AND METHODS Plant materials—The sources of plant material and vouchers/accessions used in this analysis are listed in Table 2, along with GenBank or EMBL accession numbers for the sequences. DNA extraction, gene amplification, and sequencing—Sequences for rbcL were generated at both RBG Kew and the University of Florida (Table 2); all trnL-F sequences were obtained at Kew. RBG Kew—DNA was extracted from 1.0 g fresh, 0.2–0.25 g silica gel-dried leaves, or ;0.1 g material from herbarium sheets using the 2X CTAB method of Doyle and Doyle (1987). All samples were then purified on cesium chloride/ethidium bromide gradients (1.55 g/mL density). Gene amplification of the rbcL gene was carried out using forward primers that match the first 20 or 26 base pairs (bp) of the coding region and reverse primers that correspond to 20-bp sequences that begin at position 1352 or 1367 in the coding region (Table 3; Chase and al., 1995a). The trnL-trnF region was amplified using the c and f primers of Taberlet et al. (1991). Amplified products were purified using Magic mini columns (Promega, Madison, Wisconsin) or QIAquick (Qiagen, Valencia, California) columns, following manufacturers protocols. Stan- September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS 1327 TABLE 1. Four most recent intrafamilial classifications of Amaryllidaceae s.s. The lines indicate subsequent segregation or inclusion of genera. a As Dahlgren, Clifford, and Yeo (1985) did not consistently list the component genera in their tribal concepts, their exact generic composition is inferred. Most of their delimitations are presumed to have followed Traub (1963). dard dideoxy methods or modified dideoxy cycle sequencing with dye terminators run on an ABI 373A or 377 automated sequencer (according to the manufacturer’s protocols; Applied Biosystems, Inc., Foster City, California) were used to sequence the amplification products directly. For rbcL, both strands were sequenced for 70–90% of the exon. We have ;1320 bp of rbcL sequence data for most taxa. The trnL-F region is length variable; we sequenced both strands for 70–90% of the region, obtaining between 750 and 900 bp of sequence data for most taxa. University of Florida—Genomic DNA was obtained from young fresh leaf tissue using an extraction protocol developed for plant tissues rich in soluble polysacchrides (Li, Cai, and Guy, 1994). Polymerase chain reaction (PCR) protocols were those of Li and Guy (1996). The PCR reaction product was fractionated by electrophoresis on a 0.8% low melting point agarose gel, then the DNA was purified from gel slices with phenol and chloroform and dissolved in 10 mL of 10 mmol/L Tris (pH 8.0) buffer. A 10-mL ligation reaction was prepared containing 1328 TABLE 2. Taxa, voucher specimens, and GenBank accession numbers used in the plastid DNA sequence phylogeny analyses of Amaryllidaceae. GenBank accession number Taxon Alliaceae Allium siculum var. bulgaricum A. subhirsutum L. Gilliesia graminea Lindl. Ipheion uniflorum (Graham) Raf. Leucocoryne pauciflora R. Phil. Milula spicata Prain Nothoscordum bivalve Britton Pabellonia incrassata (Phil.) Quezada and Martic. Solaria atropurpurea (Phil.) Rav. Stemmatium narcissoides Phil. Voucher rbcL trnL gene trnL-F spacer GBAN-Z69206 GBAN-Z69203 GBAN-AF117023 GBAN-AF116999 GBAN-AF117051 GBAN-AF117030 Agapanthaceae Agapanthus africanus Hoffm. Agapanthus campanulatus F. M. Leighton M. W. Chase 627 (K) M. W. Chase 1008 (K) GBAN-Z69221 GBAN-Z69220 GBAN-AF117028 GBAN-AF117029 GBAN-AF117060 GBAN-AF117059 Amaryllidaceae Amaryllis belladonna L. Apodolirion lanceolatum Benth. and Hook. Boophone disticha (L. f.) Herb. Brunsvigia comptonii W. F. Barker Caliphruria korsakoffii (Traub) Meerow Calostemma lutea Sims Chlidanthus fragrans Herb. Clivia nobilis Lindl. Crinum yemense Deflers Cryptostephanus vansonii Verdoom Cyrtanthus elatus (Jacq.) Traub Eucharis castelnaeana (Baill.) Macbr. Eucrosia eucrosioides (Pax) Traub Eustephia darwinii Vargas Galanthus plicatus M. Bieb. Gethyllis ciliaris (Thunb.) Thunb. Griffinia hyacinthina Ker Gawler Habranthus martinezii Ravenna Haemanthus humilis Jacq. Hannonia hesperidium Braun-Blanq. and Maire Hessea zeyheri Baker Hieronymiella marginata (Pax) A. T. Hunz. Hippeastrum papilio (Rav.) Van Scheepen Hymenocallis marginata (Pax.) A. T. Hunz. Ismene longipetala (Lindl.) Meerow Ismene narcissiflora Jacq. Ismene vargasii (Velarde) Gereau and Meerow Lapiedra martinezii Lag. Leptochiton quitoensis (Herb.) Sealy Leucojum autumnale L. Lycoris squamigera Maxim. Narcissus elegans (Haw.) Spach Nerine bowdenii Will. Wats. M. W. Chase 612 (K) Kirstenbosch, NBG 714/88 M. W. Chase 2246 (K) M. W. Chase 2240 (K) M. W. Chase 962 (K) M. W. Chase 1505 (K) Meerow 2312 (FLAS) M. W. Chase 3080 (K) M. W. Chase 1595 (K) Meerow 2310 (FLAS) M. W. Chase 1572 (K) Schunke 14156 (FLAS) Meerow 1117 (FLAS) M. W. Chase 559 (K) M. W. Chase 741 (K) Duncan 1123 (NBG) Meerow 2106 (FLAS) M. W. Chase 1023 (K) M. W. Chase 2025 (K) M. W. Chase 2023 (K) M. W. Chase 2238 (K) M. W. Chase 1901 (K) Meerow 2307 (FLAS) M. W. Chase 1901 (K) M. W. Chase 3583 (K) Meerow 2306 (FLAS) Meerow 2308 (FLAS) M. W. Chase 1528 (K) Meerow 1116 (FLAS) M. W. Chase 607 (K) M. W. Chase 2014 (K) M. W. Chase 617 (K) M. W. Chase 616 (K) GBAN-Z69219 GBAN-AF116944 GBAN-AF116945 GBAN-AF116946 GBAN-AF116947 GBAN-AF116948 GBAN-AF116949 GBAN-AF116950 GBAN-AF116951 GBAN-AF116952 GBAN-AF116953 GBAN-AF116954 GBAN-AF116955 GBAN-AF116956 GBAN-Z69218 GBAN-AF116957 GBAN-AF116958 GBAN-AF116959 GBAN-AF116960 GBAN-AF116961 GBAN-AF116962 GBAN-AF116963 GBAN-AF116964 GBAN-AF116965 GBAN-AF116966 GBAN-AF116967 GBAN-AF116968 GBAN-AF116969 GBAN-AF116970 GBAN-Z77256 GBAN-AF116971 GBAN-AF116972 GBAN-AF116973 GBAN-AF10479 GBAN-AF104789 GBAN-AF104801 GBAN-AF104813 GBAN-AF104810 GBAN-AF104790 GBAN-AF104770 GBAN-AF104776 GBAN-AF104784 GBAN-AF104804 GBAN-AF104818 GBAN-AF104798 GBAN-AF104788 GBAN-AF104794 GBAN-AF104799 GBAN-AF104816 GBAN-AF104771 GBAN-AF104772 GBAN-AF104781 GBAN-AF104812 GBAN-AF104813 GBAN-AF104807 GBAN-AF104775 GBAN-AF104796 N/A GBAN-AF104787 GBAN-AF104802 GBAN-AF104806 GBAN-AF104779 GBAN-AF104773 GBAN-AF104780 GBAN-AF104791 GBAN-AF104769 GBAN-AF104744 GBAN-AF104767 GBAN-AF104726 GBAN-AF104722 GBAN-AF104731 GBAN-AF104740 GBAN-AF104723 GBAN-AF104763 GBAN-AF104756 GBAN-AF104743 GBAN-AF104753 GBAN-AF104766 GBAN-AF104742 GBAN-AF104727 GBAN-AF104730 GBAN-AF104745 GBAN-AF104736 GBAN-AF104738 GBAN-AF104721 GBAN-AF104734 GBAN-AF104741 GBAN-AF104757 N/A GBAN-AF104719 GBAN-AF104768 GBAN-AF104725 GBAN-AF104732 GBAN-AF104750 GBAN-AF104755 GBAN-AF104758 GBAN-AF104733 GBAN-AF104746 GBAN-AF104751 Tristagma bivalve (Lindl.) Traub Tulbaghia violacea Harv. [Vol. 86 GBAN-AF117057 GBAN-AF117058 GBAN-AF117045 GBAN-AF117049 GBAN-AF117053 GBAN-AF117056 GBAN-AF117052 GBAN-AF117054 GBAN-AF117050 GBAN-AF117048 BOTANY GBAN-AF117001 GBAN-AF117000 GBAN-AF117018 GBAN-AF117021 GBAN-AF117025 GBAN-AF117002 GBAN-AF117024 GBAN-AF117026 GBAN-AF117022 GBAN-AF117020 OF GBAN-Z69200a GBAN-Z69205 GBAN-Z69208 GBAN-AF116992 GBAN-AF116998 GBAN-AF116991 GBAN-Z69202 GBAN-Z69209 GBAN-Z69207 N/A AMERICAN JOURNAL M. W. Chase 835 (K) M. W. Chase 439 (K) M. W. Chase 450 (K) M. W. Chase 627 (K) UC Irvine Arboretum 8182 Grey-Wilson & Phillips 752 (K) M. W. Chase 247 (NCU) UCI Arboretum 8247 M. W. Chase 693 (K) Beckett, Cheese & Watson 4688 (NY) M. W. Chase 692 (K) M. W. Chase 248 (NCU) GenBank accession number Taxon rbcL trnL gene trnL-F spacer GBAN-AF116974 GBAN-AF116975 GBAN-AF116976 GBAN-AF116977 GBAN-AF116978 GBAN-AF116979 GBAN-AF116980 GBAN-AF116981 GBAN-AF116982 GBAN-Z69217 GBAN-AF116983 GBAN-AF116984 GBAN-AF116985 GBAN-AF116986 GBAN-AF116987 GBAN-AF116988 GBAN-AF116989 GBAN-AF116990 GBAN-AF104814 GBAN-AF104778 GBAN-AF104777 GBAN-AF104809 GBAN-AF104785 GBAN-AF104805 GBAN-AF104782 GBAN-AF104783 GBAN-AF104808 GBAN-AF104800 GBAN-AF104811 GBAN-AF104793 GBAN-AF104819 GBAN-AF104792 GBAN-AF104797 GBAN-AF104786 GBAN-AF104774 GBAN-AF104815 GBAN-AF104759 GBAN-AF104718 GBAN-AF104764 GBAN-AF104729 GBAN-AF104762 GBAN-AF104735 GBAN-AF104720 GBAN-AF104754 GBAN-AF104728 GBAN-AF104739 GBAN-AF104724 GBAN-AF104747 GBAN-AF104765 GBAN-AF104748 GBAN-AF104749 GBAN-AF104760 GBAN-AF104761 GBAN-AF104737 Anthericaceae Anthericum liliago Echeandia sp. Leucocrinum montanum Nutt. ex A. Gray M. W. Chase 515 (K) M. W. Chase 602 (K) M. W. Chase 795 (K) GBAN-Z69225 GBAN-Z69225 GBAN-Z77252 GBAN-AF117005 GBAN-AF117014 GBAN-AF117003 GBAN-AF117033 GBAN-AF117039 GBAN-AF117031 Behniaceae Behnia reticulata Didr. Goldblatt 9273 (MO) GBAN-Z69226 GBAN-AF117007 GBAN-AF117035 Convallariaceae Aspidistra elatior Blume Liriope platyphylla F. T. Wang & T. Tang Peliosanthes sp. Polygonatum hookeri Baker M. M. M. M. GBAN-Z77269 GBAN-Z77271 GBAN-Z77272 GBAN-Z73695 GBAN-AF117016 GBAN-AF117009 GBAN-AF117006 GBAN-AF117010 GBAN-AF117044 GBAN-AF117038 GBAN-AF117034 GBAN-AF117036 Hemerocallidaceae Geitonoplesium cymosum Adelaide B. G. 880709 GBAN-AF116997 GBAN-AF117027 GBAN-AF117055 Hyacinthaceae Albuca shawii Baker Hyacinthus orientalis L. Ornithogalum longebracteatum Jacq. M. W. Chase 1012 (K) M. W. Chase 1503 (K) M. W. Chase 1507 (K) GBAN-Z69223 GBAN-AF116995 GBAN-Z69224 GBAN-AF117012 GBAN-AF117013 GBAN-AF117008 GBAN-AF117042 GBAN-AF117043 GBAN-AF117037 Laxmanniaceae Eustrephus latifolius R. Br. Adelaide B. G. 880587 GBAN-AF116996 GBAN-AF117004 GBAN-AF117032 Themidaceae Bessera elegans Schult. Brodiaea jolonensis Eastw. Milla magnifica E. Moore Muilla maritima S. Wats. M. W. Chase 626 (K) M. W. Chase 1831 (K) Meerow 2309 (FLAS) M. W. Chase 779 (K) GBAN-Z69215 GBAN-AF116993 GBAN-AF116994 GBAN-Z69213 GBAN-AF117015 GBAN-AF117017 GBAN-AF117011 GBAN-AF117019 GBAN-AF117040 GBAN-AF117046 GBAN-AF117041 GBAN-AF117047 a W. W. W. W. Chase Chase Chase Chase 833 (K) 1102 (K) 497 (K) 847 (K) 1329 The prefix GBAN has been added for linking the online version of American Journal of Botany to GenBank and is not part of the actual GenBank accession number. ET AL.—AMARYLLIDACEAE SYSTEMATICS Meerow 2304 (FLAS) Meerow 1142 (FLAS) Meerow 2303 (FLAS) M. W. Chase 1834 (K) Meerow 1118 (FLAS) M. W. Chase 1573 (K) M. W. Chase 1908 (K) M. W. Chase 549 (K) M. W. Chase 577 (K) M. W. Chase 1591 (K) Meerow 1159 (FLAS) M. W. Chase 615 (K) Snijman 281 (NBG) Meerow 2301 (FLAS) M. W. Chase 3640 (K) M. W. Chase 1066 (K) Meerow 2302 (FLAS) M. W. Chase 1836 (K) MEEROW Pamianthe peruviana [Stapf] Pancratium canariensis L. Paramongaia weberbaueri Valarde Phaedranassa dubia (HBK) Macbr. Proiphys cunninghamii (Ait. ex Lindl.) Mabb. Rauhia decora Ravenna Rhodophiala moelleri (R. Phil.) Traub Scadoxus cinnabaerinus (Decne.) I. Friis and I. Nordal Sprekelia formosissima (L.) Herb. Stenomesson pearcei Bak. Stenomesson variegatum (R. and P.) Bak. Sternbergia lutea (L.) Spreng. Strumaria truncata Jacq. Traubia modesta (R. A. Phil.) Ravenna Ungernia flava Boiss. ex Haussk. ex Boiss. Vagaria parviflora Herb. Worsleya rayneri (Hook.) Traub and Moldenke Zephyranthes filifolia Herb. ex Baker Voucher September 1999] TABLE 2. Continued. 1330 AMERICAN JOURNAL TABLE 3. PCR and sequencing primers for rbcL and trnL-F used in this study. Sequence rbcL Royal Botanic Gardens, Kew 59 ATGTCACCACAAACAGAAAC39 59 GCGTTGGAGAGAGATCGTTTTCT39 59 TCGCATGTACCYGCAGTTGC39 59 CTTTCCAAAATTTCACAAGCAGCA39 University of Florida 59 ATGTCACCACAAACAGAAACTAAAGCAAGT39 59 AATTTGATCTCCTTCCATATTTCGCA39 59 AAACTTTCCAAGGCCCGC39 59 GCGACTTCGGTCTTTTTC39 GGTAAACTGGAAGGGGAA39 59 GCGGGCCTTGGAAAGTTT39 59 trnL-F (Taberlet et al., 1991) 59 CGAAATCGGTAGACGCTACG39 59 ATTTGAACTGGTGACACGAG39 59 GGGGATAGAGGGACTTGAAC39 59 GGTTCAAGTCCCTCTATCCC39 Primer name 1F 636F 724R (moncots) 1368R Zurawski’s Z-1 Zurawski’s Z-1375R ALM1 (5Z-427) ALM2 ALM3 ALM4 trnL-c trnL-f trnL-d trnL-e 25 ng of pGEM-Tt vector (Promega, Madison, Wisconsin), 50–100 ng PCR products, 1 mL of 103 ligase buffer [300 mmol/L Tris-HCl, pH 7.8, 100 mmol/L MgCl2, 100 mmol/L dithiothreitol, 5 mmol/L ATP, and 1.5 U T4 DNA ligase (Promega, Madison, Wisconsin)]. The ligations were incubated at 168C overnight. One hundred microlitres of competent E. coli XL-1 Blue cells were transformed with 2.5 mL of each ligation mixture, and spread on a Luria-Bertani (LB) agar plate (100 3 15 mm) containing 50 mg/mL of ampicillin and 12.5 mL tetracycline. The plate was spread with 50 mL of 2% X-gal and 50 mL of 100 mmol/ L isopropyl-beta-D-thiogalactopyranoside before using. The plate was incubated at 378C overnight. Individual colonies were counted, and white colonies were selected to grow overnight at 378C in LB media containing 50 mg/mL ampicillin. Plasmid DNA was digested with Pst I and Sst II, and the restricted DNAs were fractionated on a 0.8% agarose gel to verify the presence of the cloned insert. Plasmid DNA containing the cloned, amplified insert was purified, and DNA sequencing was accomplished using the Taq DyeDeoxyy Terminator Cycle Sequencing Kit (Applied Biosystems Inc., Foster City, California) on an automated sequencer (Applied Biosystems Inc., Foster City, California) by the DNA sequencing Core of the Interdisplinary Center for Biotechnology Research at the University of Florida. Sequencing was accomplished using vector T7 and Sp6 primers along with specific primers for the rbcL gene received from G. Zurawski (Table 3). The complete sequence of both strands was determined using sets of synthetic primers (Table 3). Sequence alignment—Sequences of rbcL were easily aligned manually because no length variation was detected. For trnL-F, two methods were employed. Sequences of several taxa representing the range of probable variation in the matrix were aligned using the Clustal option in Sequence Navigator (Applied Biosystems, Inc.), followed by manual optimisation and alignment of subsequent sequences. Alternatively, the program Sequencher (Gene Codes, Inc., Ann Arbor, Michigan) was used to align sequences of closely related taxa with subsequent builds of these smaller alignments performed manually. Copies of the aligned matrices are available from the senior author. Analysis—Aligned matrices were analyzed using the parsimony al- OF BOTANY [Vol. 86 gorithm of the software package PAUP* for Macintosh (v4.0 d59-64, Swofford, 1998) with a successive weighting (SW; Farris, 1969) strategy. SW was employed to globally reduce the effect of highly homoplasious base positions on the resulting topologies (Lledó et al., 1998; Wenzel, 1997). Whole category weights (codon or tranversion) exhibit broad and overlapping ranges of consistency (Olmstead, 1997), whereas SW independently assesses each base position of the multiple alignment based on their consistency in the initial analysis. The initial tree search was conducted under the Fitch (equal weights; Fitch, 1971) criterion with 1000 random sequence additions and SPR (subtree pruning-regrafting) branch swapping but permitting only ten trees to be held at each step to reduce the time spent searching trees at suboptimal levels. All trees collected in the 1000 replicates were swapped on to either completion or an upper limit of 5000 trees. The characters were then reweighted by the rescaled consistency index, and a further 50 replications of random sequence additions were conducted with the weighted matrix saving 15 trees per replication. These trees were then swapped on to completion or an upper limit of 5000 trees. The resulting trees were then used to reweight the matix a second time by the rescaled consistency index, and another 50 replications of random sequence addition conducted, saving 15 trees per replication, with subsequent swapping on those trees. This cycle was repeated until two successive rounds found trees of the same length. All analyses were run with the MULPARS option and ACCTRAN optimization. Branches with zero length were collapsed if the maximum value 5 0 (‘‘amb 1’’). Internal support was determined by bootstrapping (5000 replicates) with the final reweighted character matrix and with the jackknife program (5000 replicates) of Farris et al. (1996) without SW weights applied. The cut-off bootstrap percentage is 50; minimum jackknife support percentage is 63 (Farris et al., 1996). The rbcL matrix consisted of 81 taxa, 51 Amaryllidaceae s.s. representing 48 genera, and 30 additional taxa representing 28 genera of Agapanthaceae, Alliaceae, Anthericaceae, Behniaceae, Convallariaceae, Hyacinthaceae, Laxmanniaceae, and Themidaceae, with Geitonoplesium sp. (Hemerocallidaceae) used as outgroup. The trnL-F matrix includes these same with the addition of Stemmatium narcissoides (Alliaceae). The trnL-F region consists of an intron, a short exon, and an intergene spacer (Taberlet et al., 1991). We combined the components of trnL-F because they are nearly all noncoding, but each of the two larger regions was analyzed separately to determine whether they were congruent. Because they were congruent (results not shown), we lumped them together as the ‘‘noncoding matrix’’ to compare directly with rbcL before we combined all of them. RESULTS The rbcL matrix alone—Of 1340 included base positions in the analyses, 226 were parsimony informative. More than 5000 equally most parsimonious Fitch trees were found (tree length 5 974) with a consistency index (CI) of 0.62 and a retention index (RI) of 0.71. SW produced at least 5000 equally parsimonious trees with a length of 450819 (Fitch length 5 975), a CI 5 0.88 (Fitch 5 0.62), and RI 5 0.89 (Fitch 5 0.70). The large number of equally parsimonious trees is largely the result of the short branch lengths that occur within most of the internal clades (Figs. 1–2) and the imposed constraints against collapsing zero-length branches. However, the strict consensus of the weighted trees is more resolved than that of the Fitch trees. The additional step of the SW trees is essentially the ‘‘cost’’ of optimizing consistent characters over highly homoplastic base positions (Lledó et al., 1998). The Amaryllidaceae are not resolved as monophyletic in the strict consensus of all 5000 SW trees; in these Agapanthus and Amaryllidaceae tribe Amaryllideae September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS 1331 Fig. 1. One of 5000 equally parsimonious trees generated by cladistic analysis of the successively weighted rbcL sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. An asterisk below a branch signifies that both bootstrap and jacknife 5 100%. A white bar across a branch signifies lack of resolution in the strict consensus tree of the 5000 trees. ‘‘Agapanthus afr.’’ 5 A. africanus, ‘‘Agapanthus cam.’’ 5 A. campanulatus, ‘‘Allium sub.’’ 5 A. subhirsutum, ‘‘Allium sic.’’ 5 A. siculum var. bulgaricum. The tree is continued in Fig. 2. form a polytomy with the rest of Amaryllidaceae sensu stricto (s.s.). Moreover, these clades have no bootstrap or jackknife support. The rbcL matrix (Fig. 1) resolves Hyacinthaceae/ Themidaceae as sister to Anthericaceae/Behniaceae with moderate bootstrap and jackknife support and positions this clade as sister to Agapanthus/Amaryllidaceae but with no jackknife or bootstrap support. The Alliaceae are resolved as an unsupported paraphyletic grade. In many of the trees (Fig. 1), the African tribe Amaryllideae is sister to the rest of Amaryllidaceae s.s. This monophyletic group has high bootstrap and jackknife 1332 AMERICAN JOURNAL OF BOTANY [Vol. 86 Fig. 2. One of 5000 equally parsimonious trees generated by cladistic analysis of the successively weighted rbcL sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. A white bar across a branch signifies lack of resolution in the strict consensus tree of the 5000 trees. The tree is continued in Fig. 1. support (Fig. 1). The rest of the family forms a polytomy (Fig. 2) that includes a baccate-fruited clade (Haemantheae, including Gethyllideae), the Cyrtantheae (confined to Africa), Calostemmateae (Australasia), and a monophyletic Eurasian/American group. Of these latter, only the Eurasian/American clade has any bootstrap (62) and jackknife support (67). Calostemmateae have a bootstrap percentage of 63 but no jackknife support. Within the Haemantheae, Apodolirion and Gethyllis (Gethyllideae) are resolved as sister taxa in the Fitch topologies, but not in the SW trees (Fig. 2). Within the Eurasian/American clade, the American genera are monophyletic in all trees (Fig. 2) but lack bootstrap and jackknife support. The Eurasian genera form a polytomous grade within this clade. These sequences resolve the tribe Hippeastreae (excluding Griffinia and Worsleya 5 Griffineae Ravenna emend.) and Hymenocallideae. Tribe Hippeastreae are the only clade in Amaryllidaceae s.s. other than tribe Amaryllideae that is supported by bootstrap and jackknife percentage greater than 90% (Fig. 2). Worsleya appears as sister to Chlidanthus (Eustephieae), and Griffinia is unresolved (Fig. 2). A subclade representing subtribe Zephyranthinae is supported by low bootstrap percentage, but the remaining relationships within this clade are unresolved. The rest of the American tribes (Eucharideae, Eustephieae, and Stenomesseae) are not resolved by rbcL, but one unexpected clade with weak bootstrap support (55) encompasses all September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS 1333 Fig. 3. One of 5000 equally parsimonious trees generated by cladistic analysis of successively weighted trnL-F sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. An asterisk below a branch signifies that both bootstrap and jacknife 5 100%. ‘‘Agapanthus afr.’’ 5 A. africanus, ‘‘Agapanthus cam.’’ 5 A. campanulatus, ‘‘Allium sub.’’ 5 A. subhirsutum, ‘‘Allium sic.’’ 5 A. siculum var. bulgaricum. The tree is continued in Fig. 4. the included petiolate-leafed Andean taxa with 2n 5 46 chromosomes. The trnL-F matrix alone—Of the 1389 base positions (including gaps) included in the analysis, 378 were parsimony informative. More than 5000 equally most parsimonious trees were found of length 5 1540 with CI 5 0.66 and RI 5 0.73. SW found more than 5000 equally parsimonious trees of length 5 747723 (Fitch 5 1541) with CI 5 0.89 (Fitch 5 0.66) and RI 5 0.91 (Fitch 0.73), the strict consensus of which is more resolved than the initial Fitch consensus. The trnL-F matrix (Fig. 3) resolves a monophyletic Amaryllidaceae s.s. (bootstrap and jackknife support . 80%) as sister to Alliaceae with low bootstrap (56%) and somewhat higher jackknife support (71%). Agapanthus is sister to the Amaryllidaceae/Alliaceae clade with supporting bootstrap and jackknife percentages of 81 and 87%, respectively. In all trnL-F topologies the well-supported Amaryllideae is sister to the rest of Amaryllidaceae, with high 1334 AMERICAN JOURNAL OF BOTANY [Vol. 86 Fig. 4. One of 5000 equally parsimonious trees generated by cladistic analysis of successively weighted trnL-F sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. A white bar across a branch signifies lack of resolution in the strict consensus tree of the 5000 trees. The tree is continued in Fig. 3. bootstrap and jackknife support. As with rbcL, the remaining African tribes (Haemantheae, Gethyllideae, Cyrtantheae) and Australasian Calostemmateae (itself, a well-supported clade) form an unresolved polytomy with the American/Eurasian taxa in the strict consensus (Fig 4). Unlike the rbcL topology, Gethyllideae resolves as a well-supported monophyletic subclade of Haemantheae that is sister to Haemanthus (Fig. 4). Hannonia and Lycorideae (Lycoris and Ungernia) are outside of an otherwise monophyletic Eurasian clade in which Galantheae (Galanthus and Leucojum) are resolved with high bootstrap (93%) and jackknife (92%) percentages (Fig. 4). The monophyletic Lycorideae form a weak clade with Griffinia and Hannonia as sister genera. Compared to the rbcL topology, the American genera are less resolved by trnL-F; Griffinia and Worsleya appear outside the clade comprising all other American taxa September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS 1335 Fig. 5. One of 5000 equally parsimonious trees generated by cladistic analysis of successively weighted combined rbcL and trnL-F sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. An asterisk below a branch signifies that both bootstrap and jacknife 5 100%. ‘‘Agapanthus afr.’’ 5 A. africanus, ‘‘Agapanthus cam.’’ 5 A. campanulatus, ‘‘Allium sub.’’ 5 A. subhirsutum, ‘‘Allium sic.’’ 5 A. siculum var. bulgaricum. The tree is continued in Fig. 6. (Fig. 4). The petiolate Andean clade, which appears in the rbcL consensus, loses two members, Eucharis and Rauhia. Hymenocallideae are not resolved, and Leptochiton and Pamianthe are resolved as sister genera with moderate bootstrap and strong jackknife support. Hippeastreae (less Griffineae) appear with low bootstrap support (61) but with different internal resolution than with rbcL. Again, short branch lengths are characteristic of most of the internal nodes of the American clade (Fig. 4). The combined matrix—More than 5000 equally most parsimonious trees were found of length 5 2546 with CI 5 0.64 and RI 5 0.71. SW found more than 5000 equally parsimonious trees of length 5 1194297 (Fitch 5 2546) with CI 5 0.89 (Fitch 5 0.64) and RI 5 0.89 (Fitch 5 0.71). The strict consensus of the weighted trees is more resolved than the initial Fitch consensus. Agapanthus is sister to Amaryllidaceae in the combined topologies (Fig. 5), albeit with low bootstrap support (60%). A monophy- 1336 AMERICAN JOURNAL OF BOTANY [Vol. 86 Fig. 6. One of 5000 equally parsimonious trees generated by cladistic analysis of successively weighted combined rbcL and trnL-F sequence matrix for Amaryllidaceae and other Asparagalean genera. Numbers above branches are branch lengths. Bootstrap (plain) and jackknife (boldface) percentages are below branches supported by one or both. The tree is continued in Fig. 5. letic Alliaceae is sister to the former clade, with a bootstrap of 79% and jackknife of 77%. Both Amaryllideae and Haemantheae are well-supported tribal clades (Figs. 5–6), with higher bootstrap and jackknife percentages than in either of the separate analyses, and the former resolves as sister to the rest of Amaryllidaceae s.s. Within Amaryllideae, most of the included genera resolve in a grade with Amaryllis and then Crinum as the successive sister taxa to the rest (Fig. 5). Within Haemantheae, a well-supported, monophyletic Gethyllideae is again sister to Haemanthus (Fig. 6). As in both the individual analyses, Calostemmateae and Cyrtantheae remain as part of the polytomy inclusive of Haemantheae and the large Eurasian/American clade. In the combined analysis, the Neotropical (American) and Eurasian genera are sister groups with strong boot- September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS strap and jackknife support (95, 98%), but of the two, only the American clade has weak bootstrap support (Fig. 6). Galanthus/Leucojum, Hannonia/Vagaria, and Pancratium/Sternbergia are supported sister genera, but the remaining relationships, consistent in all trees, have no support. Within the American clade (Fig. 6), a distinct Andean subclade has weak bootstrap support (68). Eustephieae have no consensus, bootstrap, or jackknife support. A well-supported Hippeastreae are in a polytomy with Griffinia, Worsleya, and the Andean clade. In Hippeastreae, a distinct Zephyranthinae and Rhodophiala/Traubia are well supported. Within the Andean clade, the resolution of Hymenocallideae, observed in the rbcL trees (Fig. 2), is lost, with Ismene, however, remaining monophyletic. Leptochiton and Pamianthe are weakly supported sister taxa. Eucharis and Rauhia fail to join the rest of a weakly supported petiolate-leafed subclade that is sister group to Hymenocallis (marked by a single synapomorphy). DISCUSSION Suprafamilial relationships of Amaryllidaceae—Fay and Chase (1996) presented a smaller rbcL analysis and argued for the inclusion of Agapanthus as a monotypic subfamily within Amaryllidaceae. The sister-group status of Agapanthus to Amaryllidaceae s.s. is only weakly supported by our combined matrix (bootstrap 5 60%). Based on these data, it would be possible to argue for recognizing Amaryllidaceae in a modified Hutchinsonian (1934) sense, i.e., with three subfamilies, Allioideae, Agapanthoideae, and Amarylloideae. Backlund and Bremer (1998) discussed the issue of monogeneric families and how best to treat them. They generated a set of guiding principles for classification: (1) primary principle of monophyly and (2) a set of secondary principles: (a) maximizing stability, (b) maximizing phylogenetic information (5 minimizing redundancy), (c) maximizing support for monophyly, and (d) maximizing ease of identification. Principle 1 is considered most important by Backlund and Bremer (1998), as it is by most modern systematists. However, the secondary principles will vary in importance among different taxa. Monophyly is maximized by either treating Agapanthus as a monogeneric family or accepting Amaryllidaceae in the Hutchinsonian sense. However, the support for a broad concept of Amaryllidaceae (including Alliaceae and Agapanthaceae) is only moderate (bootstrap 5 79%, jackknife 5 77%). The only morphological character that unites all three families is the pseudo-umbellate inflorescence (homoplasious with Themidaceae), whereas the Alliaceae are readily marked by their solid styles and sulfonated compounds, and the Amaryllidaceae have inferior ovaries and unique alkaloid chemistry. Maximizing stability in this case seems rather moot, given that Agapanthus has been maintained for years as part of Alliaceae, a classification that violates the primary principle of monophyly, and Amaryllidaceae and Alliaceae have been united on and off again over the last two centuries. However, maximizing phylogenetic information and ease of identification are best served by treating Agapanthus as the sole genus of a separate family (Agapanthaceae 1337 Voight), while maintaining the independent status of Alliaceae. The combined analysis supports most of the other relationships hypothesized by Fay and Chase (1996). The sister-group status of Themidaceae and Hyacinthaceae is confirmed with good support, and there is bootstrap support in the combined analysis for this clade as sister group to Amaryllidaceae/Alliaceae/Agapanthaceae, although Antheridaceae/Behniaceae resolves outside of this clade. It should be noted that, with this level of sampling of the broader Asparagales, these relationships are largely a matter of outgroup selection. Relationships within Amaryllidaceae—Within Amaryllidaceae s.s., several groups are well supported within all of the analyses, some of which correspond to traditionally accepted tribes of the family. The most unexpected resolution concerns the sister status of the Eurasian/American clades. This is only supported in the combined analysis, and resolution of this group in relation to the remaining African and Australasian clades is still elusive because of short branch lengths in this portion of the trees (Figs. 2, 4, 6). In a survey of internal morphology of American and African Amaryllidaceae, Arroyo and Cutler (1984) noted several characters that separated American genera from African. All American species surveyed have scapes with collenchyma, a one-layered rhizodermis, and obvolute bracts. All Amaryllideae (entirely African with the exception of pantropical Crinum) have schlerenchyma in the scape, a multilayered rhizodermis, and equitant bracts. Haemanthus and Cyrtanthus exhibit scape and root anatomy of the American species but the equitant bracts of Amaryllideae (Arroyo and Cutler, 1984). Calostemmateae (Calostemma and Proiphys), which were not discussed by Arroyo and Cutler (1984), have equitant bracts. Many of the Eurasian genera have fused spathe bracts, which obscures the pattern of their coherence, but both Lycoris and Pancratium species with free bracts show the equitant condition. Obvolute bracts may thus be a synapomorphy of the American clade. Two American subclades are found in the consensus of the combined analysis (Fig. 5), with both Griffinia and Worsleya forming a polytomy with them. The more weakly supported Andean subclade (tribes Eucharideae, Stenomesseae and Eustephieae) is characterized by 2n 5 46 chromosomes, which has been interpreted as a tetraploid derivation from an ancestral 2n 5 22 (Meerow, 1985, 1987a, c, 1989). The strongly supported Hippeastreae is characterized for the most part by x 5 6 or 11, with diploid chromosome numbers of 22, 24 or less. The short branch lengths and numerous polytomies in the Andean group (Fig. 6) may indicate that they are a relatively young clade with an evolutionary history tied closely to the geologically recent Andean uplift (Meerow, 1987c). Four recognized tribes of Amaryllidaceae are consistently resolved by the plastid DNA sequences, and all receive strong bootstrap and jackknife support in at least the combined analysis. These are the Amaryllideae, Haemantheae, Calostemmateae, and Hippeastreae. Amaryllideae—This tribe, with much of its generic diversity confined to South Africa is sister to the rest of 1338 AMERICAN JOURNAL the Amaryllidaceae and has high bootstrap and jackknife support. Compared to other tribes in Amaryllidaceae, Amaryllideae are marked by a large number of synapomorphies (Snijman and Linder, 1996): extensible fibers in the leaf tissue, bisulculate pollen with spinulose exines, scapes with a sclerenchymatous sheath, unitegmic or ategmic ovules, and nondormant, water-rich, nonphytomelanous seeds with chlorophyllous embryos. A few of the genera extend outside of South Africa proper, but only Crinum, with seeds well adapted for oceanic dispersal (Koshimizu, 1930), ranges through Asia, Australia, and America. Snijman and Linder’s (1996) phylogenetic analysis of the tribe based on morphological, seed anatomical, and cytological data resulted in recognition of two monophyletic subtribes: Crininae (Boophone, Crinum, Ammocharis, and Cybistetes) and Amaryllidinae (Amaryllis, Nerine, Brunsvigia, Crossyne, Hessea, Strumaria, and Carpolyza). Müller-Doblies and Müller-Doblies (1996) recognized four subtribes with little discussion and no phylogenetic analysis: Crininae, Boophoninae, Amaryllidinae, and Strumariinae, the latter two containing several segregate genera from Hessea and Strumaria (Table 1). Our sampling of this tribe is incomplete, and therefore we feel it is premature to attach a great deal of confidence to the generic sister relationships seen here. Four genera of Snijman and Linder’s (1996) Amaryllidinae do form a weakly supported clade (Fig. 5) with Amaryllis as sister to the rest of the tribe in the rbcL and combined analyses. Identical positioning of Amaryllis occurred in Snijman’s (1992) cladistic analyses if tribe Hippeastreae was used as the outgroup, with Haemantheae as outgroup (Snijman and Linder, 1996), and also both outgroups used (Snijman, 1992). Amaryllis resolves as sister to a clade containing the other genera they ultimately placed, with Amaryllis, in subtribe Amaryllidinae. Müller-Doblies and Müller-Doblies’ (1996) concept of Amaryllidinae [Amaryllis, Nerine, and Namaquanula (5 Hessea)] would make their subtribe Strumariinae paraphyletic and Amaryllidinae polyphyletic. Haemantheae—This baccate-fruited tribe is another morphologically well-marked group with strong molecular support. The limits of the tribe, however, have been controversial. Müller-Doblies and Müller-Doblies (1996) insisted on retaining Cyrtanthus in the tribe, albeit as a monotypic subtribe, Cyrtanthinae. The basis for uniting Cyrtanthus with the Haemantheae has always been weak, chiefly the shared chromosome number with Haemanthus (2n 5 16; Ising, 1970; Vosa and Snijman, 1984) and its strictly African range. This diploid number also occurs in some Hippeastreae (Flory, 1977; Grau and Bayer, 1991). Uniting Cyrtanthus with Haemantheae has no molecular support in our analyses, and we believe that Cyrtanthus, the only solely African genus with the flattened, winged, phytomelanous seed so common in the American clade, should be recognized as a monotypic tribe (Traub, 1963; Dahlgren, Clifford, and Yeo, 1985; Meerow and Snijman, 1998). Recognition of Gethyllideae as a distinct tribe (Müller-Doblies and Müller-Doblies, 1996; Meerow and Snijman, 1998), however, is not supported by the molecular data. Although the large, elongate, baccate fruits and small hard seeds of Apodolirion and Gethyllis are a departure from the berries and large succulent seeds OF BOTANY [Vol. 86 of the rest of Haemantheae, the two genera, though resolved as sister taxa (Figs. 4, 6), are firmly embedded within Haemantheae. Recognizing them as a distinct taxon would render the rest of Haemantheae paraphyletic. Haemantheae are the only tribe of Amaryllidaceae that contain rhizomatous genera (Cryptostephanus and Scadoxus in part), a condition that occurs in the sister family Agapanthaceae. This has generally been conceived as a plesiomorphy within the family (Nordal and Duncan, 1981; Meerow, 1995, 1997; Müller-Doblies and MüllerDoblies, 1996). In the rbcL and combined consensus trees, the three ‘‘bulbless’’ genera form a grade at the base of the Haemantheae, which would support this hypothesis, although Cryptostephanus, the only member of the tribe with the ancestral state of a phytomelanous testa, is not the first branch in the grade. Haemanthus and Scadoxus, which have been treated as one genus in the past (e.g., Hutchinson, 1934, 1959; Traub, 1963), are sister genera only in the rbcL topologies (Fig. 2). The position of Scadoxus, the only genus of the tribe polymorphic for the rhizomatous state, as the final terminal taxon in the ‘‘bulbless’’ grade seems reasonable. In any event, all three matrices render recognition of a subtribe Cliviinae for Clivia and Cryptostephanus by Müller-Doblies and Müller-Doblies (1996) as paraphyletic. Any further insight on the internal relationships within Haemantheae requires additional sampling. Calostemmateae—Calostemmateae, treated as part of a polyphyletic Eucharideae by Hutchinson (1934, 1959), Traub (1963), and Dahlgren, Clifford, and Yeo (1985), were first suggested as a distinct lineage by Meerow (1989) and formally recognized by Müller-Doblies and Müller-Doblies (1996). The tribe consists of two Australasian genera (Proiphys, forest understory herbs of Malaysia, Indonesia, the Philippines and tropical Australia, and Calostemma, endemic to Australia). A few species of Crinum, with the broadest distribution of any genus in the family, are the only other members of Amaryllidaceae present in Australia. The indehiscent capsules of both genera are similar in appearance to the unripe berry-fruits of Scadoxus and Haemanthus (Haemantheae), but early in the development of the seed, the embryo germinates precociously, and a bulbil forms within the capsule and functions as the mature propagule (Rendle, 1901). The two genera exhibit the equitant bract condition of the African and Eurasian genera. Hippeastreae—All but two of the genera treated by Meerow and Snijman (1998) as part of Hippeastreae are resolved as a well-supported monophyletic clade in all the analyses (Figs. 2, 4, 6). The two genera that lie outside of this clade are Worsleya and Griffinia, both Brazilian endemics, exhibiting the rare character of bluerange pigmentation in the flowers. The variable positioning of these two in the various analyses is interesting in itself. In the trnL-F topologies (Fig. 4), Worsleya is part of the basal polytomy within the Eurasian/American clade, whereas Griffinia weakly resolves as sister to the Mediterranean Hannonia (the latter on a long terminal branch). In the rbcL consensus (Fig. 2), Worsleya resolves as sister to Chlidanthus (Eustephieae), whereas Griffinia remains unresolved along with the rest of Eus- September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS tephieae. In the combined analysis (Fig. 6), both are positioned within the American clade, but unresolved with either Hippeastreae s.s. or the weakly supported tetraploid Andean clade. The failure of Worsleya or Griffinia to resolve as part of Hippeastreae in any of the analyses casts doubt on Müller-Doblies and Müller-Doblies’ (1996) submergence of Worsleya in Hippeastrum and weakens Meerow and Snijman’s (1998) retention of both genera in tribe Hippeastreae. Another unexpected indication of relationship occurs within the tetraploid Andean clade, where a distinct petiolate-leafed subclade is resolved in the rbcL topologies (Fig. 2). This resolution is not retained by the trnL-F and combined analyses in which Eucharis and Rauhia are pulled from this group. Nonetheless, a core of petiolate genera remain monophyletic, with weak support in the combined analysis. Despite the fact that petiolate leaves have evolved independently several times elsewhere in the Amaryllidaceae (Amaryllideae, Calostemmataceae, Haemantheae, Hymenocallideae, and Hippeastreae), the molecular data begin to indicate that it may be a synapomorphy for this group. Hymenocallideae as a distinct tribe receive weak support (55%, one synapomorphy) in the rbcL matrix only, and the rest of Stenomesseae is poorly resolved by all matrices. Within the Eurasian clade of the combined analysis (Fig. 6), Lycorideae appears as sister to the rest, although without support. This tribe represents the more or less temperate Asian component of the family, with Lycoris ranging from Korea, through China, Myanamar, and Japan, and Ungernia restricted to the mountains of central Asia. Müller-Doblies and Müller-Doblies (1978) described similarities in the bulb anatomy of Ungernia and Sternbergia, a possible synapomorphy between Lycorideae and the rest of this clade. One genus of the Eurasian clade, Pancratium, is represented throughout Africa, tropical Asia, as well as Mediterranean Europe and the Middle East, a distribution that could signify a more ancestral position within the Eurasian clade. The current data, however, do not support this resolution for Pancratium, with only a single species from the Canary Islands represented in the analyses. The presence of Pancratium in Africa may thus be secondary, though it is the only genus outside of the African tribes Amaryllideae and Haemantheae with external trichomes (Björnstad, 1973). Sister relationships of Hannonia and Vagaria receive good bootstrap and jackknife support, as does the traditional alliance of Galanthus and Leucojum. Crespo et al. (1995), using ITS sequences, refuted Müller-Doblies and Müller-Doblies’ placement of Lapiedra in Pancratieae, and our data support a closer relationship with Galantheae or Narcisseae for this genus. However, concepts of Galantheae, Narcisseae, and Pancratieae presented in Müller-Doblies and Müller-Doblies (1996) or Meerow and Snijman (1998) are not resolved in any of the three analyses, and we believe that caution should be used before categorical statements are made about tribal lineages within this group. The low internal branch lengths throughout the Amaryllidaceae, except in some of the deepest branches, are a striking contrast to the other asparagalean families included in the analysis (Figs. 1, 3, 5). The significance of this is not clear. It could mean that a great deal of the 1339 modern diversity in the family is of relatively recent occurrence (as is likely, for example, within the Andean clade), or else base substitution rates in the chloroplast genome are lower within the family than for other Asparagales. Character state evolution in the Amaryllidaceae—By optimizing morphological or other ‘‘traditional’’ characters onto a gene tree, one is able to gain insight about putative transformation series or state polarities that have characterized the evolution of the group under study. This can be useful for constructing a character state matrix for an ingroup in which rampant homoplasy in such characters confounds the endeavor. Certain characters that have been used to justify older intrafamilial classifications of Amaryllidaceae do show stability within some of the clades resolved by the combined analysis, while others appear extremely homoplasious (Fig. 7). The most notable correlation between evolutionary depth as resolved by plastid DNA sequences and morphological synapomorphies is found in the Amaryllideae (Fig. 7). All of the characters listed are synapomorphous for the tribe, which terminates the longest internal branch within Amaryllidaceae on our gene trees (Figs. 1, 3, 5). Presence or absence of bulbs—The bulbless condition occurs in the sister group to Amaryllidaceae, the monogeneric Agapanthaceae. It is also the character state for the only South African subfamily of Alliaceae, Tulbaghoideae (Fay and Chase, 1996). In Amaryllidaceae, the absence of bulbs characterizes only three genera, Clivia, Cryptostephanus, and Scadoxus, but the latter also includes species that form a true bulb. If this is a symplesiomorphy as most have interpreted it (Nordal and Duncan, 1984; Müller-Doblies and Müller-Doblies, 1996; Meerow and Snijman, 1998), the bulbous state has evolved at least three times in the family, in Amaryllideae, Haemantheae, and within the ancestral stock for the rest of the family. Petiolate leaves—Petiolate or, more accurately, pseudopetiolate leaves are widepread throughout the Asparagales, and this character exhibits a great deal of homoplasy within Amaryllidaceae (Meerow and Snijman, 1998). At the extreme, one-to-few petiolate species occur in otherwise lorate-leafed genera (e.g., Crinum, Hymenocallis). The state may occur throughout a genus, but renders a tribe polymorphic (Calostemmateae, Haemantheae, Griffineae). In the tetraploid Andean clade, a subclade is defined by the synapomorphy of a petiolate leaf in the rbcL trees, but Eucharis and Rauhia pull away with trnL-F and in the combined analyses. Mesophyll palisade—It has been suggested that the presence or absence of a distinct palisade layer in the leaf mesophyll may have systematic significance (Arroyo and Cutler, 1984; Artyushenko, 1989). Petiolate-leafed taxa never have palisade chlorenchyma (Meerow and Snijman, 1998). It is characteristic of Amaryllideae (Crinum is polymorphic), but absent in Haemantheae (the state in unknown for Gethyllis and Apodolirion). In Calostemmateae, it is present in Calostemma but absent in the petiolate Proiphys (Meerow, unpublished data). Palisade almost universally occurs in the Eurasian clade. It is ab- 1340 AMERICAN JOURNAL OF BOTANY [Vol. 86 Fig. 7. Amaryllidaceae/Agapanthaceae clade from one of 5000 equally parsimonious trees generated by cladistic analysis of the successively weighted combined rbcL and trnL-F sequence matrix for Amaryllidaceae and other Asparagalean genera with selected morphological and karyological states optimized on the tree. A ‘‘P’’ to the right of a character bar or box refers to the state being polymorphic in the adjacent taxon; if superimposed on the character bar itself, polymorphy is widespread among all adjacent taxa. ‘‘Agapanthus afr.’’ 5 A. africanus, ‘‘Agapanthus cam.’’ 5 A. campanulatus, Ismene E 5 I. subg. Elisena, Ismene I 5 I. subg. Ismene, Ismene P 5 I. subg. Pseudostenomesson, Stenomesson p. 5 S. pearcei, Stenomesson var. 5 S. variegatum. sent in Leucojum (Artyushenko, 1989), and Galanthus is polymorphic (Davis and Barnett, 1997). Within the American clade, it is wholly characteristic of the Eustephieae (Arroyo and Cutler, 1984; Meerow and Snijman, 1998) but occurs only sporadically within the Hippeas- treae (Arroyo and Cutler, 1994). The state of Worsleya is not known. Outside of Eustephieae, a distinct palisade is absent from the Andean tetraploid clade (Meerow, 1987a, 1989). The inference based on the distribution of this character state on our topology (Fig. 7) is that a distinct September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS palisade is plesiomorphic within the family, though the state within Agapanthaceae, sister to Amaryllidaceae, has not to our knowledge been reported. Pubescence—The presence of trichomes on the external parts of Amaryllidaceae is common only in some Amaryllideae and Haemantheae and one African species of Pancratium (Arroyo and Cutler, 1984; Meerow and Snijman, 1998). It is completely unknown in the American clade, Cyrtantheae, and Calostemmateae. It may have evolved independently in the three clades within which it occurs. Scape characters—Solid scapes are the predominant condition in Amaryllidaceae as occurs in Agapanthaceae as well. Hollow scapes are almost universally characteristic of Hippeastreae, and thus appears to be a synapomorphy for that tribe. The only other genera within which hollow scapes occur are Leucojum and Cyrtanthus both of which are polymorphic for the character (Traub, 1963; Reid and Dyer, 1984). As discussed previously, obvolute spathe bracts seem to be apomorphic for the American clade, and the presence of schlerenchyma in the scape is an autapomorphy for Amaryllideae. Floral symmetry—Zygomorphic and actinomorphic flowers occur in the Amaryllidaceae, and several genera (Crinum, Cyrtanthus, Phycella) are polymorphic. Snijman and Linder (1996) consider actinomorphy the apomorphic condition in Amaryllideae. The flowers of Agapanthaceae are zygomorphic. Within Haemantheae, only Clivia is zygomorphic. In the American clade, zygomorphy is the rule in the ‘‘hippeastroid’’ subclade. Pyrolirion and Zephyranthes (including Haylockia) are the only genera characterized exclusively by actinomorphic flowers, while Phycella (not included in the sequence analyses) is polymorphic. In the Andean subclade, only Eucrosia, Plagiolirion, and Ismene subgenus Elisena are exclusively zygomorphic; Rauhia is polymorphic. The Eurasian clade is on the whole actinomorphic; only Lycoris is characterized by zygomorphic flowers. The mosaic occurrence of actinomorphy throughout the family (Fig. 7) and the occurrence of polymorphic genera suggest that transformations between the two states of floral symmetry may be easily modified by pollinator-mediated selection, and perhaps controlled by one or few genes. Paraperigone—The ‘‘paraperigone’’ is an anomalous secondary outgrowth of the perianthal meristem with ramifying vasculature (Arber, 1939; Singh, 1972), not to be confused with a similar-looking structure formed by staminal connation (see below). It is most well developed (and typified) by the corona of Narcissus. Such a welldeveloped paraperigone occurs in only one other genus, the Chilean endemic Placea (Hippeastreae). However, a homologous series of fimbrae, scales, or a continuous callose ring occurs in Cryptostephanus (Haemantheae), one or two species of Cyrtanthus, and variably thoughout Lycorideae and Hippeastreae. It has thus probably evolved at least three times (Haemantheae, Cyrtantheae, and the Eurasian/American clade), but from a meristematic potential that is deep rooted in the family. Polymorphism 1341 for this character within genera may suggest that it is easily lost. Staminal connation—The fusion of the staminal filaments was the single most important character with which Traub (1957, 1963) justified recognizing his ‘‘infrafamily’’ Pancratioidinae, a subfamilial taxon that in fact was glaringly polyphyletic. Though staminal connation is a widespread character state within the Andean tetraploid clade (Fig. 7), it is paralleled elsewhere in the family, particularly in Amaryllideae subtribe Amaryllidinae (Snijman and Linder, 1996), the Calostemmateae, in Gethyllis, and some species of Cyrtanthus (Reid and Dyer, 1984). In the Eurasian clade it occurs in Pancratium, the flower morphology in general of which bears striking resemblance to several Andean genera (Hymenocallideae pro parte, Paramongaia, and Pamianthe). Meerow and Dehgan (1985) attemepted to link these socalled ‘‘pancratioid’’ genera by pollen morphology, but a more parsimonious explanation may be convergence for pollinator specificity (Morton, 1965; Bauml, 1979; Grant, 1983). However, Pancratium and these Andean genera are monophyletic in a larger sense (as part of the Eurasian/American clade), and the exact position of Pancratium within the Eurasian subclade is still not strongly resolved (Fig. 6). Fruit and seed characters—Fruit and seed morphology have been an important focus of experimentation within the family. Baccate fruits have apparently evolved only once, despite the difference in gross morphology between the long, aromatic fruit of Gethyllis and Apodolirion and the berries of the rest of Haemantheae. Phytomelan [the ancestral state for all Asparagales (Huber, 1969)] has been lost from the testa as many as five times in the Amaryllidaceae: in Amaryllideae, Griffineae, Hymenocallideae, Haemantheae, and Calostemmateae [in Calostemmateae a true seed never forms, but an integumentary rudiment is present (Rendle, 1901)]. In both Haemantheae and Hymenocallideae, phytomelan is found around the seeds of one genus each (Cryptostephanus and Leptochiton, respectively). The loss of one integument [or both, as been controversially reported for some Crinum (Prillieux, 1858; von Schlimbach, 1924; Tomita, 1931; Markötter, 1936, but see Snijman and Linder, 1996)] is synapomorphic for Amaryllideae. A flattened, winged seed, which occurs in Agapanthaceae, is very common in the American clade, but otherwise occurs only in Ungernia (Lycorideae) and Cyrtantheae. The most similar type of seed to this is the Dshaped seed of Worsleya and some Pancratium. A dry, hard, wedge-shaped or irregularly round seed is characteristic of most of the Eurasian clade (except Lycorideae), frequently with an elaiosome at the chalazal end. Among all genera of the family, Pancratium is the most polymorphic for seed type (Werker and Fahn, 1975). Characterization of certain seeds of Amaryllidaceae as fleshy (regardless of whether phytomelan is present) has led, in the past, to false homologies (see discussion in Meerow, 1989). Truly fleshy seeds occur in Amaryllideae (in which case the bulk of the seed volume is endosperm; Rendle, 1901), Hymenocallideae (the fleshy portion is integumentary; Whitehead and Brown, 1940), and some 1342 AMERICAN JOURNAL water-rich Haemantheae. But an ‘‘intermediate’’ state occurs in a number of genera in which the seed is round, turgid, but not really fleshy (the seed will burst under pressure rather than give way), and contains copious, oily endosperm. This type of morphology is found in Cryptostephanus (Haemantheae), Lycoris (Lycorideae), Eucharideae sensu Meerow (1989), Griffinia, and a single species of Hippeastrum. Chromosome number—A chromosome number of 2n 5 22 is considered plesiomorphic in Amaryllidaceae due to the broad occurrence in many of the tribes of the family (Goldblatt, 1976; Flory, 1977; Meerow, 1984, 1987b). Andean-centered genera in the tribes Eucharideae, Eustephieae, Hymenocallideae, and Stenomesseae are characterized by a somatic chromosome number of 2n 5 46 or presumptive derivations thereof (Di Fulvio, 1973, Flory, 1977; Williams, 1981; Meerow, 1987a, b). Resolution of these genera as a clade in our plastid DNA trees supports the interpretation of a monophyletic polyploid origin for these tribes from an ancestor with 2n 5 22 via chromosome fragmentation or duplication and subsequent doubling or vice versa (Satô, 1938; Lakshmi, 1978; Meerow, 1987b). Biogeographic implications—Raven and Axelrod (1974) postulated a western Gondwanaland origin for Amaryllidaceae sensu Huber (1969), and this is supported by the plastid DNA phylogeny. The deepest branches of the topology originate in Africa, including the sister group of the family Agapanthus. Africa has also been the site of considerable innovation in the family’s history as well, as typified by the Afrocentric tribes Amaryllideae, Haemantheae, and Cyrtantheae. Most of the diversity within those three tribes is, however, centered in South Africa, and thus may reflect radiation engendered by the more recent paleoclimatic and geological history of Africa encompassing Neogene and later times (Axelrod, 1972; Raven and Axelrod, 1974). The increased aridity of the African climate and the uplift of the continental mass beginning near the end of the Oligocene, further abetted by Quaternary climatic fluctuations, were catastrophic to many elements of the African flora, but it may have been a selective pressure for diversity among groups of geophytes capable of adapting to increasing drought. The geophyte richness of South Africa is well documented (Goldblatt, 1978), and the Cape region has been suggested as a possible refuge for certain African plant and animal groups as the tropical flora of the continent was impoverished (Raven and Axelrod, 1974). However, the three basal genera of the baccate-fruited Haemantheae according to our combined analysis (Fig. 6), Clivia, Cryptostephanus, and Scadoxus, are all forest understory taxa, do not form bulbs, and are at least in part (Scadoxus, Cryptostephanus) elements of tropical vegetation farther north. Cryptostephanus does not occur in South Africa at all, and this is the only genus of Haemantheae in which the plesiomorphic state of a phytomelanous testa occurs. The Calostemmateae, the only exclusively Australasian element of the family, may have been isolated from the African lineages as Australia separated from western Gondwanaland (Raven and Axelrod, 1974). Direct migration between Africa and Australia may have persisted OF BOTANY [Vol. 86 up through the close of the early Cretaceous, although India and Madagascar may have provided a less direct corridor up until the late Cretaceous (Raven and Axelrod, 1974). That the Calosternmateae remains within the unresolved grade of otherwise African tribes would suggest relative antiquity for the lineage. Crinum is the only amaryllid that is known to occur on Madagascar, despite the island’s probable role as a refuge for taxa decimated by the Neogene African extinctions, whereas indigenous Indian amaryllids are restricted to Crinum and two to three species of Pancratium. The adaptations of Crinum for long-distance dispersal have been demonstrated (Koshimizu, 1930), and Pancratium may have been able to directly enter India from either Africa or Eurasia during the late Cretaceous or early Eocene (Raven and Axelrod, 1974). The sister relationship of the Eurasian/Mediterranean clade to the American genera raises the interesting question of when and where the Amaryllidaceae, in the main, entered the New World. It should be noted that this probably occurred at least twice, as the arrival of Crinum in the Americas via oceanic dispersal was undoubtedly an unrelated event (Arroyo and Cutler, 1984). Although migration between Eurasia and North America has been possible throughout most of angiosperm history (Raven and Axelrod, 1974), the hypothesized pathways have been for plants of temperate forest biota and not considered to be important for plants of subhumid or semiarid vegetation (Raven, 1971, 1973). However, eastern North America and western Europe may have shared a warm, seasonally dry climate from the late Cretaceous to the early Eocene (Axelrod, 1973, 1975), which might have allowed east/west movement of species, with island chains of the Mid-Atlantic ridge providing stepping stones. Such a Madrean-Tethyan hypothesis would have the initial entry of the Amaryllidaceae into the New World through North America. Although there are members of the family in Mexico and the southern United States, they are, with the exception of the ubiquitous Crinum, components of terminal subclades (Zephyranthes, Habranthus, Hymenocallis) in an overall American phylogeny based on nuclear DNA ITS sequences (Meerow, Guy, and Li, 1998), all of which are linked to more basal taxa endemic to South America. The validity of the Madrean-Tethan hypothesis has more recently been questioned by various studies using isozyme, plastid DNA restriction fragment length polymorphisms (RFLPs), or cladistic analyses of taxa considered emblematic of the disjunction: Buxus (Köhler and Brückner, 1989), Datisca (Liston, Rieseberg, and Hanson, 1992), Lavatera (Ray, 1994), Quercus (Manos, 1992; Nixon, 1993), Pinus (Little and Crutchfield, 1969; Miller, 1993), and Styrax (Fritsch, 1996). In these cases, the hypothesized Madrean-Tethyan linkage is not resolved as monophyletic, the taxon itself is not monophyletic, or the estimated time of divergence does not fit the Madrean-Tethyan hyothesis. Given the extant distribution of Amaryllidaceae in North America and the generic richness south of the equator, a northern latitude entry into the New World for the family would necessitate massive extinction in North America sometime after migration to South America took place. Glaciation would be the likely factor involved. Little migration of plants from North America to South September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS America probably took place before the Eocene (Raven and Axelrod, 1974). All indications are that the movement of extant Amaryllidaceae has been northward from South America (e.g., Meerow, 1987b, 1989). This does not necessarily preclude an earlier, initial arrival in North America, migration to South America, and a more recent, but secondary, return of some elements of the family to North America long after glaciation extirpated the founder populations. However, if a North American entry is hypothesized, this begs the question of why the Eurasian sister clade has been so successful in adapting to temperate habitats, which constitute the majority of the species in tribes Galantheae, Narcisseae, and Lycorideae, whereas the American clade is relatively depauperate of temperate climate adaptation. There is nothing in our data to prove or disprove an initial New World entry of the Amaryllidaceae into North America, and the issue is for the present unresolved. In conclusion, our combined analysis of plastid DNA sequences rbcL and trnL-F provide good support for the monophyly of the Amaryllidaceae and indicate Agapanthaceae as its likely sister family. The Alliaceae are in turn sister to the Amaryllidaceae/Agapanthus clade. The origins of the family are African. The phylogenetic relationships with Amaryllidaceae s.s. resolve strongly along biogeographic lines. The tribe Amaryllideae, primarily South African and well supported by numerous morphological synapomorphies, is sister to the rest of Amaryllidaceae. The remaining two African tribes of the family, Haemantheae and Cyrtantheae, are well supported, but their position relative to the Australasian Calostemmateae and a large clade comprising the Eurasian/ American genera, is not yet clear. The Eurasian elements of the family and the American genera are monophyletic sister clades. Internal resolution of the Eurasian clade only partially supports currently accepted tribal concepts, and few conclusions can be drawn on the relationships of the genera based on these data. A monophyletic Lycorideae (Central and East Asian) is weakly supported. Galanthus and Leucojum (Galantheae pro parte) are supported as sister genera by the Bootstrap. The American clade shows a higher degree of internal resolution. A monophyletic Hippeastreae (less Griffinia and Worsleya) is well supported, and a distinct subtribe, Zephyranthinae, is resolved as well. A distinct Andean clade marked by a chromosome number of 2n 5 46 and derivations thereof is resolved with weak support, and a distinct petiolate Andean subclade composed of elements of the tribes Eucharideae and Stenomesseae is partially resolved with weak support. The lack of resolution of Griffinia and Worsleya in the overall American clade, and of Eustephieae in the Andean subclade, may indicate that these genera represent more isolated elements of the American lineage. LITERATURE CITED ADANSON, M. 1763. Famille des plantes. Paris. ARBER, A. 1937. Studies in flower structure III. On the corona and androecium in certain Amaryllidaceae. Annals of Botany II, 1: 293– 304. ARROYO, S. C., AND D. F. CUTLER. 1984. Evolutionary and taxonomic aspects of the internal morphology in Amaryllidaceae from South America and Southern Africa. Kew Bulletin 39: 467–498. 1343 ARTYUSHENKO, Z. T. 1989. Aspects of research on Amaryllidaceae Jaume. Herbertia 45: 131–137. AXELROD, D. I. 1972. Edaphic aridity as a factor in angiosperm evolution. American Naturalist 106: 311–320. ———. 1973. History of the Mediterranean ecosystem in California. In F. di Castri and H. A. Mooney [eds.], Mediterranean type ecosystems: origin and structure, 225–227. Springer-Verlag, Berlin. ———. 1975. Evolution and biogeography of Madrean-Tethyan scleophyll vegetation. Annals of the Missouri Botanical Garden 62: 280–334. BACKLUND, A., AND K. BREMER. 1998. To be or not to be—principles of classification and monotypic plant families. Taxon 47: 391–400. BAKER, J. G. 1888. Handbook of the Amaryllideae. Goerge Bell and Sons, London. BAUML, J. A. 1979. A study of the genus Hymenocallis (Amaryllidaceae) in Mexico, M.S. thesis, Cornell University, Ithaca, NY. BENTHAM, G., AND J. D. HOOKER. 1883. Genera plantarum, vol. 3. L. Reeve, London. BJÖRNSTAD, I. N. 1973. A revision of the genus Pancratium L. (Amaryllidaceae) in Africa south of the Sahara. Norwegian Journal of Botany 20: 281–291. BROWN, R. 1810. Prodomus 1: 296–293. London. BRUIJN, A. Y. DE, M. W. CHASE, A. V. COX, P. J. RUDALL, M. A. T. JOHNSON, AND L. E. EGUIARTE. In review. Phylogenetics of Asphodelaceae (Asparagales): an analysis of plastid rbcL and trnL-F DNA sequences. Submitted to Annals of Botany. CAMERON, K. M., M. W. CHASE, W. M. WHITTEN, P. J. KORES, D. C. JARRELL, V. A. ALBERT, T. YUKAWA, H. G. HILLS, AND D. H. GOLDMAN. 1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208–224. CHASE, M. W., ET AL. 1993. Phylogenetics of seed plants: an analysis of nucleotide sequences from the plastid gene rbcL. Annals of the Missouri Botanical Garden 80: 528–580. ———, M. R. DUVALL, H. G. HILLS, J. G. CONRAN, A. V. COX, L. E. EGUIARTE, J. HARTWELL, M. F. FAY, L. R. CADDICK, K. M. CAMERON, AND S. HOOT. 1995a. Molecular phylogenetics of Lilianae. In P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humphries [eds.], Monocotyledons: systematics and evolution, vol. 1, 109–137. Royal Botanic Gardens, Kew. ———, D. W. STEVENSON, P. WILKIN, AND P. J. RUDALL. 1995b. Monocot systematics: a combined analysis. In P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humphries [eds.], Monocotyledons: systematics and evolution, vol. 2, 685–730. Royal Botanic Gardens, Kew. CRESPO, M. B. M., D. LLEDÓ, M. F. FAY, AND M. W. CHASE. 1996. Molecular phylogeny of Leucojum based on ITS sequences. American Journal of Botany 83 (suppl.): 149 (Abstract). CRONQUIST, A. 1988. The evolution and classification of flowering plants, 2d ed. New York Botanical Garden, Bronx, NY. DAHLGREN, R. M. T., AND H. T. CLIFFORD. 1982. The monocotyledons: a comparative study. Academic Press, London. ———, AND F. N. RASMUSSEN. 1983. Monocotyledon evolution: characters and phylogenetic analysis. Evolutionary Biology 16: 255– 395. ———, H. T. CLIFFORD, AND P. F. YEO. 1985. The families of monocotyledons: structure, evolution, and taxonomy. Springer-Verlag, Berlin. DAVIS, A. P., AND J. R. BARNETT. 1997. The leaf anatomy of the genus Galanthus L. (Amaryllidaceae J. St.-Hil.). Botanical Journal of the Linnean Society 123: 333–352. DE JUSSIEU, A. L. 1789. Genera plantarum. Paris. DI FULVIO, T. E. 1973. Contribucı́on al conocimiento cariológico de Amaryllidaceae. Estudio cromosómico en Hieronymiella y otras genéros afines. Kurtziana 7: 117–131. DOYLE, J. J., AND J. L. DOYLE. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf tissue. Phytochemistry Bulletin 19: 11–15. DUVALL, M. R., M. T. CLEGG, M. W. CHASE, W. D. CLARK, W. J. KRESS, H. G. HILLS, L. E. EGUIARTE, J. F. SMITH, B. S. GAUT, E. A. ZIMMER, G. H. LEARN, Jr. 1993. Phylogenetic hypotheses for the monocotyledons constructed from rbcL data. Annals of the Missouri Botanical Garden 80: 607–619. 1344 AMERICAN JOURNAL FARRIS, J. S. 1969. A successive approximations approach to character weighting. Systematic Zoology 18: 374–385. ———, V. A. ALBERT, M. KÄLLERSJÖ, D. LIPSCOMB, AND A. G. KLUGE. 1996. Parsimony jackknifing outperforms neighbor-joining. Cladistics 12: 99–124. FAY, M. F., AND M. W. CHASE. 1996. Resurrection of Themidaceae for the Brodiaea alliance, and recircumscription of Alliaceae, Amaryllidaceae and Agapanthoideae. Taxon 45: 441–451. ———, A. W. MEEROW, J. HARTWELL, AND M. W. CHASE. 1995. Molecular systematics and biogeography of the Amaryllidaceae. American Journal of Botany 82 (suppl.): 129 (Abstract). FITCH, W. M. 1971. Toward defining the course of evolution: minimum change for a specific tree topology. Systematic Zoology 20: 406– 416. FLORY, W. S. 1977. Overview of chromosomal evolution in the Amaryllidaceae. Nucleus 20: 70–88. FRITSCH, P. 1996. Isozyme analysis of the intercontinental disjuncts within Styrax (Styracaceae): implications for the Madrean-Tethyan hypothesis. American Journal of Botany 83: 342–355. GIELLY, L., AND P. TABERLET. 1994. The use of chloroplast DNA to resolve plant phylogenies: noncoding versus rbcL sequences. Molecular Biology and Evolution 11: 769–777. ———, AND ———. 1996. A phylogeny of the European gentians inferred from chloroplast trnL (UAA) intron sequences. Botanical Journal of the Linnean Society 120: 57–75. ———, Y. M. YUAN, P. KUPFER AND P. TABERLET. 1996. Phylogenetic use of noncoding regions in the genus Gentiana L.: chloroplast trnL (UAA) intron versus nuclear ribosomal internal transcribed spacer sequences. Molecular Phylogenetics and Evolution 5: 460–466. GOLDBLATT, P. 1976. Chromosome cytology of Hessea, Strumaria, and Carpolyza (Amaryllidaceae). Annals of the Missouri Botanical 63: 314–320. ———. 1978. An analysis of the flora of southern Africa: its characteristics, relationships, and origins. Annals of the Missouri Botanical Garden 65: 369–436. GRANT, V. 1983. The systematic and geographical distribution of hawkmoth flowers in the temperate North American flora. Botanical Gazette 144: 439–449. GRAU, J., AND E. BAYER. 1991. Zur systematischen Stellung der Gattung Traubia Moldenke (Amaryllidaceae). Mitteilungen der Botanischen Staatssammlung München 30: 479–484. HERBERT, W. 1837. Amaryllidaceae. J. Ridgeway and Sons, London. HUBER, H. 1969. Die Sammenmerkmale und verwandtschafts verhaltnisse der Liliiflorae. Mitteilungen der Botanischen Staatssammlung München 8: 219–538. HUTCHINSON, J. 1934. Families of flowering plants, vol. 2. Monocotyledons, 1st ed. MacMillan, London. ———. 1959. Families of flowering plants, vol. 2. Monocotyledons, 2nd ed. Clarendon Press, Oxford. ISING, G. 1970. Evolution of karyotypes in Cyrtanthus. Hereditas 65: 1–28. JAUME-SAINT-HILAIRE, J. H. 1805. Exposition de familles naturales. 1. Paris. KIM, J. H., H. T’HART, AND T. H. MES. 1996. The phylogenetic position of East Asian Sedum species (Crassulaceae) based on chloroplast DNA trnL (UAA)-trnF (GAA) intergenic spacer sequence variation. Acta Botanica Neerlandica 45: 309–321. KITA, Y., K. UEDA, AND Y. KADOTA. 1995. Molecular phylogeny and evaluation of the Asian Aconitum subgenus Aconitum (Ranunculaceae). Journal of Plant Research 108: 429–442. KÖHLER, E., AND P. BRÜCKNER. 1989. The genus Buxus (Buxaceae): aspects of its differentiation in space and time. Plant Systematics and Evolution 162: 267–283. KOSHIMIZU, T. 1930. Carpobiological studies of Crinum asiaticum L. var. japonicum Bak. Memoirs of the College of Sciences, Kyoto Imperial University, Series, B., Biology 5: 183–227. LAKSHMI, N. 1978. Cytological studies in two allopolyploid species of the genus Hymenocallis. Cytologia 43: 555–563. LI, Q.-B., Q. CAI, AND C. L. GUY. 1994. A DNA extraction method for RAPD analysis from Plants rich in soluble polysaccharides. Plant Molecular Biology Reporter 12: 215–220. ———, AND C. L. GUY. 1996. Prolonged final extension time increases cloning efficiency of PCR products. BioTechniques 21: 192–196. OF BOTANY [Vol. 86 LINDLEY, J. 1836. The vegetable kingdom, 2nd ed. Bradbury and Evans, London. LINNEAUS, C. 1753. Species plantarum. Stockholm. LITTLE, E. L., AND W. B. CRITCHFIELD. 1969. Subdivisions of the genus Pinus (Pinus). United States Department of Agriculture Forest Service Miscellaneous Publication 1144. LISTON, A., L. H. REISEBERG, AND M. A. HANSON. 1992. Geographic partitioning of chloroplast SNA variation in the genus Datisca (Datiscaceae). Plant Systematics and Evolution 181: 121–132. LLEDÓ, M. D., M. B. CRESPO, K. M. CAMERON, M. F. FAY, AND M. W. CHASE. 1998. Systematics of plumbaginaceae based upon cladistic analysis of rbcL sequence data. Systematic Botany 23: 21–29. MAGUIRE, T. L., J. G. CONRAN, G. G. COLLINS, AND M. SEDGLEY. 1997. Molecular analysis of interspecific and intergeneric relationships of Banksia using RAPDs and non-coding chloroplast DNA sequences. Theoretical and Applied Genetics 95: 253–260. MANOS, P. 1992. Cladistic analysis of molecular variation of ‘‘higher’’ Hamamelididae and Fagaceae, and systematics of Quercus section Protobalanus. Ph.D. dissertation, Cornell University, Ithaca, NY. MARKÖTTER, E. I. 1936. Die lewensgeskiedenis van sekere geslagte van die Amaryllidaceae. Annals of the University of Stellenbosch XIV.A.2: 1–84. MEEROW, A. W. 1984. Karyotype evolution in the Amaryllidaceae. Herbertia 40: 139–154. ———. 1985. The evolutionary significance of pancratioid floral morphology in the Amaryllidaceae. American Journal of Botany 72: 962 (Abstract). ———. 1987a. A monograph of Eucrosia (Amaryllidaceae). Systematic Botany 12: 429–461. ———. 1987b. Biosystematics of tetraploid Eucharis (Amaryllidaceae). Annals of the Missouri Botanical Garden 74: 291–309. ———. 1987c. Chromosome cytology of Eucharis, Caliphruria, and Urceolina. American Journal of Botany 74: 1559–1575. ———. 1989. A monograph of the Amazon lilies, Eucharis and Caliphruria (Amaryllidaceae). Annals of the Missouri Botanical Garden 76: 136–220. ———. 1995. Towards a phylogeny of the Amaryllidaceae. In P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humphries [eds.], Monocotyledons: systematics and evolution, 169–179. Royal Botanic Gardens, Kew. ———. 1997. Response to Müller-Doblies & Müller-Doblies (1996). Feddes Repertorium 108 (7–8): S.c. 1–3. ———, AND B. DEHGAN. 1985. The auriculate pollen grain of Hymenocallis quitoensis Herb. (Amaryllidaceae) and its systematic implications. American Journal of Botany 72: 540–547. ———, C. L. Guy, and Q.-B. Li. 1998. Phylogeny of neotropical Amaryllidaceae based on nrDNA ITS sequences. American Journal of Botany 85 (Supplement): 144 (Abstract). ———, AND D. A. SNIJMAN. 1998. Amaryllidaceae. In K. Kubitzki [ed.], Families and genera of vascular plants, vol. 3, 83–110. Springer-Verlag, Berlin. MES, T. H. M., G. J. WIJERS, AND H. T’HART. 1997. Phylogenetic relationships in Monanthes (Crassulaceae) based on morphological, chloroplast and nuclear DNA variation. Journal of Evolutionary Biology 10: 193–216. ———, J. VAN BREDERODE, AND H. T’HART. 1996. Origin of the woody macaronesian Sempervivoideae and the phylogenetic position of the East African species of Aeonium. Botanica Acta 109: 477–491. MILLER, C. I. 1993. Impact of the Eocene on the evolution of Pinus L. Annals of the Missouri Botanical Garden 80: 471–498. MORTON, J. K. 1965. The experimental taxonomy of the West African species of Pancratium L. (Amaryllidaceae). Kew Bulletin 19: 337– 347. MÜLLER-DOBLIES, D., AND U. MÜLLER-DOBLIES. 1978. Bulbs and morphology: Ungernia. Lagascalia 8: 13–23. ———, AND ———. 1996. Tribes and subtribes and some species combinations in Amaryllidaceae J. St.-Hil. emend. R. Dahlgren and al. 1985. Feddes Repertiorum 107 (5–6): S.c. 1–9. NIXON, K. C. 1993. Infrageneric classification of Quercus (Fagaceae) and typification of sectional names. Annals of Science and Forestry 50 (supplement 1): 25–34. September 1999] MEEROW ET AL.—AMARYLLIDACEAE SYSTEMATICS NORDAL, I., AND T. DUNCAN. 1984. A cladistic analysis of Haemanthus and Scadoxus. Nordic Journal of Botany 4: 145–153. OLMSTEAD, R. G. 1997. Is there a specific gene for a specific problem? Advances in Plant Molecular Systematics, First International Symposium of the Systematics Association, University of Glasgow (Abstract), Systematics Association, Glasgow. ———, AND J. D. PALMER. 1994. Chloroplast DNA systematics: a review of methods and data analysis. American Journal of Botany 81: 1205–1224. ———, AND J. A. SWEERE. 1994. Combining data in phylogenetic systematics—an empirical approach using 3 molecular data sets in the Solanaceae. Syst. Biol. 43: 467–481. PAX, F. 1888. Amaryllidaceae. In A. Engler and K. Prantl [eds.], Die naturlichen pflanzenfamilien II. Teil 5, 97–124. Verlag von Wilhelm Engelmann, Leipzig. PRILLIEUX, E. 1858. De la structure et du mode formation des graines bulbiformes de quelques Amaryllidées. Annales de Sciences Naturales 4: 97–104. RAVEN, P. H. 1971. The relationships between ‘‘mediterranean’’ floras. In P. H. Davis, P. C. Harper, and I. G. Hedge [eds.], Plant life of south-west Asia, 119–134. Botanical Society, Edinburgh. ———. 1973. Plant species disjunctions: a summary. Annals of the Missouri Botanical Garden 59: 234–246. ———, AND D. I. AXELROD. 1974. Angiosperm biogeography and past continental movements. Annals of the Missouri Botanical Garden 61: 539–673. RAY, M. F. 1994. Biogeography and systematics of Lavatera and Malva (Malvaceae) species. American Journal of Botany 81: 199 (Abstract). REID, C., AND R. A. DYER. 1984. A review of the Southern African species of Cyrtanthus. American Plant Life Society, La Jolla, CA. RENDLE, A. B. 1901. The bulbiform seeds of certain Amaryllidaceae. Journal of the Royal Horticultural Society 26: 89–96. RUDALL, P. J., M. W. CHASE, D. F. CUTLER, J. R. RUSBY, AND A. Y. DE BRUIJN. 1998. Anatomical and molecular systematics of Asteliaceae and Hypoxidaceae. Botanical Journal of the Linnean Society 127: 1–42. SANG, T, D. J. CRAWFORD, AND T. F. STUESSY. 1997. Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany 84: 1120–1136. SATÔ, D. 1938. Karyotype evolution and phylogeny. IV. Karyotype in Amaryllidaceae with special reference to SAT chromosomes. Cytologia 9: 203–242. SINGH, V. 1972. Floral morphology of the Amaryllidaceae. 1. Subfamily Amaryllidoideae. Canadian Journal of Botany 50: 1555–1565. 1345 SNIJMAN, D. A. 1992. Systematic studies in the tribe Amaryllideae (Amaryllidaceae), Ph.D. dissertation, University of Cape Town, Capetown. ———. 1994. Systematics of Hessea, Strumaria and Carpolyza (Amaryllideae: Amaryllidaceae). Contributions from the Bolus Herbarium 16. Capetown. ———, AND H. P. LINDER. 1996. Phylogenetic relationships, seed characters, and dispersal system evolution in Amaryllideae (Amaryllidaceae). Annals of the Missouri Botanical Garden 83: 362–386. SOLTIS, D. E., P. S. SOLTIS, M. E. MORT, M. W. CHASE, V. SAVOLAINEN, S. B. HOOT, AND C. M. MORTON. 1998. Inferring complex phylogenies using parsimony: an empirical approach using three large DNA data sets for angiosperms. Systematic Biology 47: 32–42. STEVENSON, D. W., AND H. LOCONTE. 1995. Cladistic analysis of monocot families. In P. J. Rudall, P. J. Cribb, D. F. Cutler, and C. J. Humphries [eds.], Monocotyledons: systematics and evolution, vol. 2, 685–730. Royal Botanic Gardens, Kew. SWOFFORD, D. L. 1998. Phylogenetic analysis using parsimony, v. 4.01 beta. Sinauer, Sunderland, MA. TABERLET, P., L. GIELLY, G. PAUTOU, AND J. BOUVET. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1110. TAKHTAJAN, A. 1969. Flowering plants: origin and dispersal. Oliver and Boyd, London. THORNE, R. F. 1976. A phylogenetic classification of the Angiospermae. Evolutionary Biology 9: 35–106. TOMITA K. 1931. Über die Entwicklung des nackten Embryos von Crinum latifolium L. Science Report of Tohoku Imperial University IV, Biology 6: 163–169. TRAUB, H. P. 1963. Genera of the Amaryllidaceae. American Plant Life Society, La Jolla, CA. VON SCHLIMBACH, H. 1924. Beiträge zur Kenntnis der Afrikanischen Flora V. Bulletin de la Herbarium Boissier 4: 809–846. VOSA, C. G., AND D. A. SNIJMAN. 1984. The cytology of the genus Haemanthus L. (Amaryllidaceae). Journal of South African Botany 50: 237–259. WENZEL, J. W. 1997. When is a phylogenetic test good enough? Memoires de la Musee Nationale del’Histoire Naturelle 173: 31–45. WERKER, E., AND A. FAHN. 1975. Seed anatomy of Pancratium species from three different habitats. Botanical Gazette 136: 396–403. WHITEHEAD, M. R., AND C. A. BROWN. 1940. The seeds of the spider lily Hymenocallis occidentalis. American Journal of Botany 27: 199–203. WILLIAMS, M. D. 1981. Chromosome count for Paramongaia weberbaueri Velarde. Plant Life 37: 83–89.

RELATED PAPERS

RELATED TOPICS

Log In

Systematics of Amaryllidaceae Based on Cladistic Analysis of Plastid RBCL and TRNL-F Sequence DATA1

Systematics of Amaryllidaceae Based on Cladistic Analysis of Plastid RBCL and TRNL-F Sequence DATA1

Related Papers

RELATED PAPERS

RELATED TOPICS