Molecular Phylogeny Estimation of the Bamboo Genus Chusquea (Poaceae: Bambusoideae: Bambuseae) and Description of Two New Subgenera

Amanda E. Fisher; Lynn G. Clark; Scot A. Kelchner

This study provides a first broad systematic treatment of the euagarics as they have recently emerged in phylogenetic systematics. The sample consists of 877 homobasidiomycete taxa and includes approximately one tenth (ca. 700 species) of the known number of species of gilled mushrooms that were traditionally classified in the order Agaricales. About 1000 nucleotide sequences at the 5′ end of the nuclear large ribosomal subunit gene (nLSU) were produced for each taxon. Phylogenetic analyses of nucleotide sequence data employed unequally weighted parsimony and bootstrap methods. Clades revealed by the analyses support the recognition of eight major groups of homobasidiomycetes that cut across traditional lines of classification, in agreement with other recent phylogenetic studies. Gilled fungi comprise the majority of species in the euagarics clade. However, the recognition of a monophyletic euagarics results in the exclusion from the clade of several groups of gilled fungi that have been traditionally classified in the Agaricales and necessitates the inclusion of several clavaroid, poroid, secotioid, gasteroid, and reduced forms that were traditionally classified in other basidiomycete orders. A total of 117 monophyletic groups (clades) of euagarics can be recognized on the basis on nLSU phylogeny. Though many clades correspond to traditional taxonomic groups, many do not. Newly discovered phylogenetic affinities include for instance relationships of the true puffballs (Lycoperdales) with Agaricaceae, of Panellus and the poroid fungi Dictyopanus and Favolaschia with Mycena, and of the reduced fungus Caripia with Gymnopus. Several clades are best supported by ecological, biochemical, or trophic habits rather than by morphological similarities.

The temperate bamboos (tribe Arundinarieae) are notorious for being taxonomically extremely difficult. China contains some of the world’s greatest diversity of the tribe Arundinarieae, with most genera and species endemic. Previous investigation into phylogenetic relationships of the temperate bamboos revealed several major clades, but emphasis on the species-level relationships among taxa in North America and Japan. To further elucidate relationships among the temperate bamboos, a very broad sampling of Chinese representatives was examined. We produced 9463 bp of sequences from eight non-coding chloroplast regions for 146 species in 26 genera and 5 outgroups. The loci sequenced were atpI/H, psaA-ORF170, rpl32-trnL, rpoB-trnC, rps16-trnQ, trnD/T, trnS/G, and trnT/L. Phylogenetic analyses using maximum parsimony and Bayesian inference supported the monophyly of Arundinarieae. The two major subtribes, Arundinariinae and Shibataeinae, defined on the basis of different synflorescence types, were indicated to be polyphyletic. Most genera in this tribe were confirmed to be paraphyletic or polyphyletic. The cladograms suggest that Arundinarieae is divided into ten major lineages. In addition to six lineages suggested in a previous molecular study (Bergbamboes, the African alpine bamboos, Chimonocalamus, the Shibataea clade, the Phyllostachys clade, and the Arundinaria clade), four additional lineages were recovered in our results, each represented by a single species: Gaoligongshania megalothyrsa, Indocalamus sinicus, Indocalamus wilsonii, Thamnocalamus spathiflorus. Our analyses also indicate that (1) even more than 9000 bp of fast-evolving plastid sequence data cannot resolve the inter- and infra-relationships among and within the ten lineages of the tribe Arundinarieae; (2) an extensive sampling is indispensable for phylogeny reconstruction in this tribe, especially given that many genera appear to be paraphyletic or polyphyletic. Perhaps the ideal way to further illuminate relationships among the temperate bamboos is to sample multiple nuclear loci or whole chloroplast sequences in order to obtain sufficient variation.

, a large, economically important genus of woody bamboos. DNA sequences of the internal transcribed spacer (ITS) region of nuclear ribosomal DNA (nrDNA) were used in a parsimony analysis. Phyllostachys was well supported as monophyletic with Chimonobambusa as its closest allied genus. The 5S spacer region of nrDNA was investigated but found unsuitable for this purpose. The AFLP analysis showed much higher discriminating power between species and was more useful for phylogenetic reconstruction at this taxonomic level. The combined data were used to review the previous infra-generic classifications. Section Heteroclada Wang & Ye is strongly supported and can be further divided into sub-groups. A group within section Phyllostachys is strongly supported, but a further group of taxa previously included in this section is difficult to place. The ability of the methods to help separate species such as P. sulphurea and investigate genetic diversity at the infra-specific level was also assessed. It is argued that AFLPs could often be the method of choice for phylogenetic studies of closely related taxa for which DNA sequence data provide insufficient resolution.

Systematic Botany (2014), 39(3) © Copyright 2014 by the American Society of Plant Taxonomists DOI 10.1600/036364414X681554 Date of publication 05/27/2014 Molecular Phylogeny Estimation of the Bamboo Genus Chusquea (Poaceae: Bambusoideae: Bambuseae) and Description of Two New Subgenera Amanda E. Fisher,1,4 Lynn G. Clark,2 and Scot A. Kelchner3 1 Rancho Santa Ana Botanic Garden, Claremont Graduate University, Claremont, California 91711-3157, U. S. A. Department of Ecology, Evolution and Organismal Biology, Iowa State University, Ames, Iowa 50011-1020, U. S. A. 3 Department of Biological Sciences, Idaho State University, Pocatello, Idaho 83209-8007 U. S. A. 4 Author for correspondence (afisher@rsabg.org) 2 Communicating Editor: Jimmy Triplett Abstract—Chusquea is a diverse genus of American woody bamboos, accounting for almost half of the woody bamboo species in the Neotropics. Previous analyses of molecular data have recovered four major lineages within Chusquea, but morphological synapomorphies have been identified only for subgenus Rettbergia. This study estimates a chloroplast phylogeny of Chusquea with a focus on relationships within the large and intractable Euchusquea clade. Phylogenetic analyses were conducted on 40% of the described species in Chusquea, with data from five chloroplast regions and a preliminary survey of the nuclear internal transcribed spacer complex. Several results from previous studies were corroborated, including the presence of two clades formerly comprising the genus Neurolepis and monophyly of subgenus Rettbergia. The clades formerly in Neurolepis are named as Chusquea subgenus Platonia and Chusquea subgenus Magnifoliae based on molecular support and potential morphological synapomorphies. We recovered two strongly supported and five weakly supported clades within Euchusquea, but relationships among these lineages were not resolved and species composition of the clades conflicts strongly with current taxonomic groupings based on morphology. Low resolution of the chloroplast phylogeny estimation, low variability in nuclear data, character conflict, and geographical distribution of chloroplast lineages all suggest a recent radiation of the Euchusquea clade. Given the present weak molecular support for relationships within Euchusquea and the lack of synapomorphic morphological characters to define clades, we recommend the use of the current morphology-based taxonomy as a practical means of assessing and describing diversity in the Euchusquea clade. Keywords—Bamboo, Neotropical radiation, chloroplast phylogeny, grass evolution, Shimodaira-Hasegawa test. Chusquea Kunth is the most diverse genus of Neotropical woody bamboos, with 169 described species and estimates of as many as 220 species in total ( Judziewicz et al. 1999; Fisher et al. 2009). It is the sole genus in subtribe Chusqueinae Soderstr. & Ellis and is well supported by molecular data as monophyletic (Kelchner and Clark 1997; Clark et al. 2007; Fisher et al. 2009; Kelchner and Bamboo Phylogeny Group 2013). Detailed reviews of the nomenclatural and taxonomic history of Chusquea can be found in Fisher et al. (2009) and Clark (1989). Following the recent taxonomic submergence of Neurolepis Meisn. within Chusquea (Fisher et al. 2009), diagnosable morphological characters for Chusquea are (i) spikelets with four glumes and a single, terminal, fertile floret lacking a rachilla extension, and (ii) the presence of two papillae on subsidiary cells of the foliar stomatal complex. Lack of aerial branching, a single bud per node, and strongly nerved ligules appear to be plesiomorphic in the genus. Chusquea species are found in mountainous regions of the Neotropics and austral temperate zone (21! N-47! S), with centers of diversity in Mexico, Central America, the northern Andes, and southeastern Brazil. These bamboos primarily occur in montane forests and high-elevation grasslands and tend to occupy specialized habitats such as Andean páramos, Brazilian campos de altitude, Araucaria forests, Nothofagus forests, and Mexico’s pine-oak forests (McClure 1973; Soderstrom and Calderón 1978b; Veblen 1982; Clark 1992; Londoño 1996; Clark 1997; Judziewicz et al. 1999; Safford 1999). The dominant vegetation in these highelevation grasslands often consists of Chusquea species such as C. pinifolia (Nees) Nees and C. heterophylla Nees in southeastern Brazil, C. subtessellata Hitchc. in Costa Rica’s Talamanca range (Tol and Cleef 1994), C. spencei Ernst and C. angustifolia (Soderstr. & C. E. Calderón) L. G. Clark in Venezuelan páramos, C. tessellata Munro in Colombian ‘bamboo páramos,’ and C. stuebelii (Pilg.) L. G. Clark, C. aristata Munro, C. rigida (L. G. Clark) L. G. Clark, and C. nana (L. G. Clark) L. G. Clark in Ecuador (Laegaard 1992; Clark 1996). Many Chusquea species are able to aggressively colonize areas disturbed naturally or by humans (Judziewicz et al. 1999) and some species can form dense thickets in montane forests. Once established, Chusquea bamboos may inhibit germination of surrounding plants by creating a thick leaf litter (Tol and Cleef 1994) or by limiting understory light (Widmer 1997; Holz and Veblen 2006; Giordano et al. 2009). In some cases, Chusquea species are primary drivers of tree regeneration cycles. For example, mature stands of C. montana Phil., C. uliginosa Phil. (as C. tenuiflora Phil.), and C. culeou E. Desv. in austral Andean beech forests can out-compete shade intolerant Nothofagus seedlings (Veblen 1982). Eventually, the monocarpic Chusquea flower and senesce, allowing a new cohort of Nothofagus to grow at an accelerated rate (Holz and Veblen 2006). Excluding subg. Platonia and subg. Magnifoliae (Neurolepis I and II clades), Chusquea characteristically have abundant vegetative branching derived from multiple buds per node and solid culms (McClure 1973; Clark 1989, 1997), but otherwise exhibit considerable morphological variation (Fig. 1). Species in montane forests are typically scandent to clambering on surrounding vegetation, but species in high-elevation grasslands have an erect and shrubby habit. Chusquea have unusually complex vegetative branch complements due to the presence of up to 200 buds at each stem node. These buds are commonly dimorphic, with distinctive arrangements of a single large central bud and two to many smaller subsidiary buds (Soderstrom and Calderón 1978a; Clark 1989). Previous work identified the sister group to Chusquea (Clark et al. 2007; Fisher et al. 2009) and provided a preliminary molecular survey of the genus (Kelchner and Clark 1997). Chusquea collections were first described as Nastus Juss. and were viewed by later authors as being closely SYSTEMATIC BOTANY [Volume 39 Fig. 1. Chusquea classification and morphological variation. Photographs of characteristic species for each group are arranged below each heading, within the orange outline. Five subgenera (gray boxes) are listed, including the newly described subg. Platonia (Neurolepis I) and subg. Magnifoliae (Neurolepis II). Within subg. Chusquea there are five sections (white boxes). With the exception of subg. Magnifoliae and subg. Platonia, Chusquea species tend to have abundant vegetative branching and they exhibit considerable variation in their bud complement, branch complement, and overall habit. Photographs by L. G. Clark except C. subtessellata and C. pohlii by A. E. Fisher. aligned with Nastus based on the shared character of a single floret per spikelet (Kunth 1816; Desvaux 1831; Nees von Esenbeck 1835; Munro 1868). Although Kelchner and Clark (1997) found evidence that one sampled Neurolepis species is sister to Chusquea s. s., morphological analyses suggested a sister relationship between Chusquea and Nastus + Hickelia A. Camus (Clark 1997). Clark et al. (2007) explicitly tested these two hypotheses and found that Chusquea + Neurolepis (Chusqueinae) is sister to an Arthrostylidiinae + Guaduinae clade with chloroplast rpl16 intron data, even though morphological data resolve Chusqueinae as sister to the Ehrhartoideae (rice) subfamily (Clark et al. 2007). Phylogenetic estimation based on a five region chloroplast dataset by Kelchner and Bamboo Phylogeny Group (2013) corroborated the rpl16 intron data of Clark et al. (2007), but refuted analyses based on morphology in that there is a moderately supported sister relationship between the Chusqueinae and an Arthrostylidiinae + Guaduinae clade. Importantly, Clark et al.’s (2007) molecular analysis of the one-flowered bamboos unexpectedly recovered two distinct lineages of Neurolepis paraphyletic to Chusquea. Fisher et al. (2009) verified the paraphyletic chloro- plast relationship of Neurolepis and Chusquea with increased taxon sampling and statistical testing of alternative hypotheses. The two Neurolepis lineages are now submerged into Chusquea as subg. Platonia and subg. Magnifoliae. Three additional subgenera have been recognized (subg. Chusquea, subg. Rettbergia (Raddi) L. G. Clark, subg. Swallenochloa (McClure) L. G. Clark, Table 1) and are mainly defined by differences in habit, branching pattern, and bud arrangement (Clark 1989, 1992, 1997). Using sequence data from the chloroplast rpl16 intron, Kelchner and Clark (1997) found that the sampled species of subg. Rettbergia are monophyletic, whereas subg. Swallenochloa and subg. Chusquea are polyphyletic within a larger, well-supported clade informally referred to as the Euchusquea clade. Despite these earlier analyses of the genus based on molecular data and recent work across the Bambusoideae (Sungkaew et al. 2009; Kelchner and Bamboo Phylogeny Group 2013), little is known about evolutionary relationships within Chusquea, especially within the species-rich Euchusquea. The current study was devised to test the monophyly of taxonomic groups within Euchusquea and to provide a more complete phylogenetic framework for Chusquea. To that end, 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA Table 1. A summary of the genus Chusquea. Species are classified into five subgenera and then into sections or informal groups. For each taxon the table lists the number of species, the morphological characteristics, and known distribution, habitat, and elevation preferences. subg. Chusquea sect. Chusquea sect. Longifoliae Species # Characteristics 88 20 2–1 subsidiary buds; triangular or circular central bud Extravaginal branching; several to many subsidiary buds per node Infravaginal branching; triangular central bud; 18–80 subsidiary buds per node; long, narrow foliage leaf blades Viny to arching or pendant habit; scabrid culm leaves; infravaginal branching; subsidiary buds in a usually tight circular cluster; elongated central bud prophylls; glume II twice as long as glume I Viny with long, scabrid internodes; infravaginal branching; 2–12 subsidiary buds per node; foliage leaf blades relatively long and wide Crescent or fully encircling verticil of subsidiary buds; thin foliage leaf blades; dorsally compressed spikelets; reduced glumes I and II Pseudopetiolate culm leaf blade that remains green 11 sect. Longiprophyllae 6 sect. Serpentes 6 sect. Verticillatae 18 C. ramosissima group 3 C. meyeriana group 5 subg. Rettbergia 11 subg. Swallenochloa 39 sect. Swallenochloa 39 C. culeou group 3 C. heterophylla group 2 C. mimosa group 4 subg. Platonia (Neurolepis I) 11 subg. Magnifoliae (Neurolepis II) 10 Spatheate bracts often subtending the synflorescence; reflexed lower inflorescence branches; reduced glumes I and II Clambering habit; circular central bud; infravaginal branching; arachnoid subsidiary branches; spatheate bracts usually subtending the synflorescence; connate lemma apices Shrubby habit; erect culms; shortened waxy internodes; triangular central bud; subsidiary buds forming a crescent below or linearly flanking the central bud; intravaginal or extravaginal branching; tessellate leaf blades Subsidiary buds forming a crescent below or linearly flanking the central bud; intravaginal branching; short, waxy internodes; thick, stiff foliage leaf blades; narrowly paniculate synflorescences; irregular flowering or short cycles. Usually subequal, linearly arranged buds lacking an obvious dominant central bud Erect, fastigiate culms; subsidiary buds forming a crescent below the dominant central bud; extravaginal branching; small leaves (< 15 cm) Erect culms that arch distally; deciduous culm and foliage leaf sheaths; scarious culm and foliage leaf sheath margins; dimorphic or trimorphic bud complements Lacking aerial branching; internodes 1–14 cm long (relatively elongated); foliage leaf blades (8-)16–180 cm L, 1–6.3(–8.3) cm W (except for N. nobilis); absent to short pseudopetioles; glumes usually with well developed awns Lacking aerial branching; internodes 1–3 cm long (relatively compressed); foliage leaf blades (20–)30–300(–377) cm L, 1.2–24(–30) cm W; pseudopetioles well developed; glumes usually lacking awns 65 Chusquea species (40% of the total number of described species) were sampled for five chloroplast regions and the nuclear region ITS. Species sampling included representatives from all of the described taxonomic groups, spanned the geographic distribution of the genus, and encompassed prominent features of morphological diversity in Chusquea s. l. (Fisher et al. 2009). Materials and Methods Taxon and Character Sampling—Leaf material for 65 species of Chusquea and three outgroup taxa (Appendix 1) was collected from Distribution and Habitat Widespread Mid- and high-elevation forests of Andes Montane forests of southern Mexico, Central America, and northern Andes Montane forests of northern Andes, with five spp. restricted to the cordilleras of Colombia Montane forests of Mexico, Central America, and northern Andes Mid- to low-elevation montane forests of Mexico, Central America, and northern Andes Atlantic and lowland forests of Misiones, Argentina, Paraguay, and Brazil Brazil, especially Atlantic forest Brazilian montane and Atlantic forests, except C. arachniformis, which is endemic to montane forests of northwestern Colombia Usually open habitats, often at high elevation; widespread, but most diverse in subpáramos and páramos of the northern Andes, Central America, and campos de altitude of eastern Brazil Widespread distribution and habitat preferences, as in subg. Swallenochloa Open meadows and Nothofagus forest understory in the austral Andes (0–2,000m) Brazilian campos de altitude Mid- to high-elevation forests in Brazil; C. nudiramea is also found in low-elevation Atlantic forests Upper montane forest and páramos of Ecuador and Colombia; C. fimbriligulata extends into northern Peru Central America, northern and central Andes, Trinidad, Guyana, and northern Brazil young branches and immediately dried in silica gel. Vouchers are deposited at ISC, US, INB, and CR. Three outgroups were chosen from the Arthrostylidiinae + Guaduinae Neotropical woody bamboo clade, the lineage that is estimated to be sister to the Chusqueinae in recent molecular phylogenetic studies (Clark et al. 2007; Sungkaew et al. 2009; Kelchner and Bamboo Phylogeny Group 2013). Five chloroplast regions were used in the analysis: rpl16 intron, ndhA intron, trnD-trnT intergenic spacer, trnT-trnL intergenic spacer, and ndhF gene. The nuclear internal transcribed spacer complex (ITS1, 5.8S, ITS2) was also surveyed for potential information. The individual chloroplast regions were chosen based on prior use in bamboos (Kelchner and Clark 1997; Zhang 2000; Clark et al. 2007; Triplett and Clark 2010) and variation of these regions across seed plants (Shaw et al. 2005; Shaw et al. 2007). SYSTEMATIC BOTANY Although there can be serious issues with paralogy determination when using ITS in phylogenetic studies (Alvarez and Wendel 2003), the region was sampled in this study after repeated failure to amplify more desirable low-copy nuclear loci (GBSSI and rpb2), presumably due to degraded DNA in our dried leaf tissue. The ITS region was sequenced with the goal of assessing its variation in Chusquea and as a potential means of corroborating the topology derived from chloroplast data. Because evidence indicates there are multiple copies of ITS present in Chusquea’s genome and we did not clone PCR amplicons, we take a cautious approach to the use and interpretation of our ITS data. DNA Isolation, Amplification, and Sequencing—Total genomic DNA was isolated from silica-gel-dried leaf samples with either Extract-N-Amp kits (Sigma-Aldrich, St. Louis, Missouri) or Qiagen DNEasy plant mini kits (Qiagen, Inc., Valencia, California) using the following modifications to the Qiagen kit protocol: 35–50 mg of dry leaf material, 500 ml of lysis buffer, and a final wash with cold EtOH. Samples extracted with the Extract-N-Amp kit were subsequently cleaned with Qiagen PCR purification columns. Cleaned total genomic DNA served as the template for PCR amplification and sequencing reactions for each molecular region (protocols and primers as in Table 2). Three primers were trialed for ITS (Table 2) in two pairwise combinations (Prince and Kress 2006). Direct sequencing of 18SF-26SR amplicons resulted in multiple sequences in the same chromatogram and this primer pair was abandoned owing to inadequate resources for cloning. However, direct sequencing of ITSL26SR amplicons resulted in a single sequence except that, in a few cases, ITSL-26SR amplicons were of two lengths. In these cases, the band of length consistent with this ITS copy in other Chusquea species was excised with a Wizard SV gel and PCR clean-up kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions. Forty-nine Chusquea species and one outgroup were sampled for the ITS nuclear region. Sequencing was carried out on an Applied Biosystems 3130XL genetic analyzer (Applied Biosystems, Foster City, California) at the Idaho State University Molecular Research Core Facility or on an Automated 3730XL DNA Analyzer (Applied Biosystems) at the Iowa State University DNA Sequencing and Synthesis Facility. Sequence files were manually checked for base-calling errors using the program 4Peaks 1.7.2 (Griekspoor and Groothuis 2006). Alignment and Data Exploration—Edited sequences were aligned by hand in Se-Al 2.0 (Rambaut 2001). The criterion-based manual alignment [Volume 39 of gaps followed Kelchner (2000), Graham et al. (2000), and Borsch et al. (2003). Shared microstructural changes, including insertions, deletions, and hairpin inversion events were coded as absent or present in a 0/1 matrix after probable biological origins for the events were inferred from the surrounding sequence. Nucleotide characters of insertiondeletion regions were then excluded from the dataset in phylogenetic analyses. Areas with ambiguous alignments, such as variation between sequences due to mononucleotide repeats, were also excluded during analyses. Sequences were searched against the National Center for Biotechnology Information (NCBI) nucleotide collection database (nr/nt) to evaluate their similarity to the target regions in grasses. Indices of nucleotide base frequencies, uncorrected-p distances, and number of parsimony informative characters were assessed using PAUP* v4b10 (Swofford 2003). Neighbor-net analyses of uncorrected-p distances were performed in SplitsTree 4 (Huson and Bryant 2006) to assess character conflict in individual and combined datasets (Morrison 2010). In addition, secondary structures of ITS sequences were modeled on the Mfold server (http://mfold.rna.albany.edu; Zuker 2003) in order to reduce the likelihood of including paralogous sequences (including pseudogenes) or sequences of fungal origin (Feliner and Rosselló 2007). Model Selection—Models of nucleotide evolution for individual data sets and the combined chloroplast data were evaluated using dynamic likelihood ratio tests (dLRT) and the Akaike information criterion (AIC) method as implemented in jModelTest (Posada 2008). Likelihood scores were computed within jModelTest using PhyML (Guindon and Gascuel 2003) with 88 candidate models, 11 substitution schemes, and options for unequal base frequencies, proportion of invariant sites (I), and rate variation among sites. Multiple models were considered best-fit for the data if AIC differences were D £ 2. Phylogenetic Tree Estimation—Phylogenetic analyses were performed on the chloroplast and ITS nuclear data separately, to account for the possibility that the organellar and nuclear genomes track separate evolutionary histories. Tree topologies and support values resulting from different estimation frameworks (Bayesian inference, maximum likelihood, and maximum parsimony) were compared for each dataset to assess robustness of tree topology to changes in model assumptions. Time intensive analyses that could be facilitated by parallel processing were run on the Idaho State University EGG Bioinformatics computing cluster. Table 2. Molecular regions used in this study, PCR amplification primers, and thermocycler protocols. Primers labeled SEQ were favored for sequencing, but were also used for amplification. Primer sequences were obtained from the following publications: ITS nuclear region 18SF, 26SR (Prince and Kress 2006); ITS nuclear region ITSL (Hsiao et al. 1995); ndhA intron SAK26 & SAK28 (Watts et al. 2008); ndhF gene 972F, 2110R, 1318F and 1603R (Olmstead and Sweere 1994); rpl16 intron F71, R1516 (Kelchner and Clark 1997); trnD-trnT intergenic spacer trnDF & trnTR (Demesure et al. 1995); trnT-trnL intergenic spacer TABA, TABB (Taberlet et al. 1991). Touchdown PCR was used to amplify ndhF and trnD-trnT intergenic spacer by reducing the annealing temperature of each cycle -1! C, until a target temperature is reached, followed with additional cycles at this annealing temperature (Don et al. 1991). 1,000 bp trnD-trnT intergenic spacer 1,100 bp trnT-trnL intergenic spacer 880 bp 94! C, 1m; 10 (94! C, 1m 30s; touchdown 53–43! C, 2m; 72! C, 3m); 20 (94! C, 1m 30s; 43! C, 2m; 72! C, 3m); 72! C 10m. + rpl16 intron + 1,140 bp 80! C, 5m; 35 (95! C, 1m; 50! C, 1m; +15! C, 0.3! C/s; 65! C, 5m); 65! C, 4m. + ndhF gene (3’ end) (94! C, 1m 30s; 58! C, 2m; 72! C, 1m); 72! C, 7m. 80! C, 5m; 35 (95! C, 1m; 50! C, 1m; +15! C, 0.3! C/s; 65! C, 5m); 65! C, 4m. + 800 bp 30 94! C, 2m; 35 (94! C, 45s; touchdown 58–48.5! C, 1m; 72! C, 1m 15s); 72! C, 5m. + ndhA intron 18SF: CGATTGAATGGTCCGGTGAAG (54.4! C) 26SR: AGGACGCTTCTACAGACTACAA (53! C) ITSL: TCGTAACAAGGTTTCCGTAGGTG(55.3! C) SAK26: CAATATCTCTACGTGYGATTCG (! C) SAK28: AACTGTTRGATAATCATAGTCG (47.4–49.2! C) SAK43: TCTTTTTCAGGTGGTCTACGAG (53! C) SAK44: ACTGTGCTTCAACTATATCAAC (49.9! C) 927F: GTCTCAATTGGGTTATATGATG (48.9! C) 2110R: CCCCCTAYATATTTGATACCTTCTCC (55.2! C) SEQ:1318F: GGATTAACTGCGTTTTATATGTTTCG (55.2! C) 1603R: GCATAGTATTTCCCGTTTCATGAGG (56! C) F71: GCTATGCTTAGTGTGTGACTCGTTG (57.7! C) SAK7: GAACGACAGAACCTATGA (45.8! C) SAK8: CCATCCCACCCAATGAAG (53.2! C) R1516: CCCTTCATTCTTCCTCTATGTTG (53! C) R1661: CGTACCCATATTTTTCCACCACGAC (57.9! C) TrnDF: ACCAATTGAACTACAATCCC (48.5! C) SAK9F: ACCAATTGAACTACAATCCC (50.2! C) SAK10R: GCATAAGTCATCGGTTCAAATC (51.7! C) trnTR: CCCTTTTAACTCAGTGGTA (48.8! C) SEQ: SAK2R: TGCCCCTATCGTCTAGTGGT (53.8! C) SAK1F: GGATTTGAACCAGCGTATACA (50.5! C) TABA: CATTACAAATGCGATGCTCT (48.5! C) TABB: TCTACCGATTTCGCCATATC (49.7! C) AFIP1: TAAGGAGAACATAGAATCATAGC (50.5! C) AFIP2: GCTATGATTCTATGTTCTCCT (49! C) 80! C, 5m; 35 (95! C, 1m; 50! C, 1m; +15! C, 0.3! C/s; 65! C, 5m); 65! C, 4m. + 800 bp + ITS 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA Bayesian inference (BI) estimation was performed in MrBayes 3.1 (Huelsenbeck and Ronquist 2001) using the general time reversible (GTR) model, with estimates of invariant characters (I) and substitution rate variation (G) parameters as recommended by Huelsenbeck and Rannala (2004). Analysis of the combined chloroplast data included partitions for each region plus coded microstructural changes (with a standard discrete model specified for the microstructural data). In separate analyses of the partitioned chloroplast and ITS nuclear datasets the following settings were used: 40 million generations, two runs, four chains per run, sampling every 2,000 generations, heating temperature of 0.2, and a burn-in of 10,000 trees. Priors were set to Dirichlet on base frequencies and the rate matrix, exponential on branch lengths, and uniform on the gamma shape parameter (a), proportion of invariable sites (I), and topology. MrBayes output files for each run were combined to estimate sample size scores in Tracer 1.4.1 (Rambaut and Drummond 2007). Convergence of the posterior distribution was considered to have occurred when the average standard deviation of split frequencies fell below 0.01 and likelihood values appeared to be stable over several thousand generations. Maximum likelihood (ML) analyses were performed in PhyML ver. 2.4.4 (Guindon and Gascuel 2003) using one of the best-fit models determined in jModelTest. Nonparametric bootstrap (BS) analyses were conducted with 1,000 replicates to evaluate support for branches. Maximum parsimony (MP) analyses were conducted in PAUP* 4b10 using a two-step “long-thin” search process (Kelchner 2003). This method was used to estimate a robust topology across frameworks and facilitate extensive BS analyses and was not intended for recovery of the most parsimonious tree(s) from the data set. Sequences were added randomly for 1,000 repetitions of heuristic search, with no more than 100 trees greater than or equal to length 1 kept in memory for each repetition. The second step of searching used the subsequent pool of 100,000 trees as starting trees and swapped branches to completion. Trees generated in the second step were combined in a strict consensus topology. Support for branches was evaluated in PAUP* v4b10 using two nonoptimal, heuristic approaches after a conventional BS search (search = heuristic addseq = random nreps = 10,000) ran for more than two months on an iMac G5 (Apple Inc., Cupertino, California). A lack of phylogenetic information may have overwhelmed tree-bisection-reconnection branch swapping during a conventional exhaustive PAUP* bootstrap search (Sullivan 2005). Instead, we trialed a parsimony fast-step BS analysis and an analysis using a single optimal tree held in memory with tree-bisectionreconnection branch swapping (parsimony single tree; Mort et al. 2000). Alternative Hypothesis Testing—Relationships in the chloroplast phylogeny estimation and the morphological classification of Chusquea present competing hypotheses of evolution. Shimodaira-Hasegawa tests (SH tests; 1999) were conducted to compare several sets of hypotheses. The unconstrained maximized likelihood estimate (MLE) tree of combined chloroplast data was tested in a series of two-tree comparisons against MLE trees with monophyletic constraints on each subgenus or section previously described for Chusquea (three subgenera and seven sections). Trees were considered significantly different given the chloroplast data and best-fit model if p < 0.05 for the test distribution. After the initial phylogenetic analyses suggested that a geographic signal might be present in the data, a second series of SH tests compared the chloroplast unconstrained MLE tree to a number of alternative hypotheses based on geographical distribution. Species occurring in five separate geographic regions were constrained to be monophyletic in individual MLE analyses: austral Andes, Brazil, Brazilian species excluding subg. Rettbergia, northern Andes, and central American + Mexican species. In addition, a single SH test compared the ITS MLE tree to a topology with a constraint on a monophyletic subg. Swallenochloa sect. Swallenochloa. Isolation By Distance—To explore scenarios of evolution in subg. Rettbergia and Euchusquea, genetic distances were compared with physical distances (Slatkin 1993). An isolation by distance analysis was conducted on a dataset that sampled across subg. Rettbergia and Euchusquea and a dataset that sampled only within Euchusquea. Uncorrected-p distances of the chloroplast data were calculated in PAUP* v4b10 and latitude and longitude values were recorded from herbarium labels for the accessions sampled in this study. A distance matrix was calculated with the software Geographic Distance Matrix Generator v. 1.2.3 (Ersts 2009). Results Chloroplast and Nuclear Sequence Data—The combined chloroplast alignment contains 5,278 nucleotide characters for 68 species (0.71% missing data) and a binary matrix of 88 inferred microstructural characters (Appendix S1, TreeBASE study number TB2:S14424). BLAST searches returned sequences of the expected regions from Bambusoideae as top matches. The combined chloroplast alignment includes 446 variable characters and 260 parsimonious informative characters (dataset characteristics available in Appendix S2), and uncorrected-p distances were small for both the chloroplast and nuclear regions (0.0064–0.0167). No region contains a unique sequence for each species, although the combined chloroplast data set does. In Chusquea, the ndhA intron is the least variable region, with 114 taxon pairs sharing identical sequences. The trnDtrnT region has the highest combined number of variable nucleotides and microstructural changes in the chloroplast dataset (144), but many of these changes are not informative (70). The trnT-trnL region is one of the shorter alignments, but contains a moderate number of variable characters (78), a high percentage of which are informative (79%). Although it adds informative data to the analysis, trnT-trnL was difficult to amplify and sequence due to five regions of mononucleotide repeats over six bases long within a 250 bp section. Two internal primers (AFIP1, AFIP2) were designed to overcome polymerase failure during trnT-trnL amplification, requiring four sequencing runs to obtain the entire region for most samples. The ndhF gene showed variation comparable to the non-coding regions and, in this study, it contained more parsimony informative nucleotide characters (52) than the other chloroplast regions, except trnD-trnT (58). Most of the parsimony informative characters supplied by ndhF provide support for branches deep in the tree topology, particularly those leading to the outgroups and subg. Platonia and subg. Magnifoliae. Nucleotide sequences of the ITS region were generated for 50 taxa. Because we were not able to clone amplicons, these data are of limited value and we use them here only as a preliminary survey of nuclear sequence variation in Chusquea and to check for broad patterns of hierarchical signal at the nuclear level. We do not consider the data sufficient for phylogeny estimation of Chusquea nuclear relationships. BLAST searches of ITS sequences generated in this study returned bamboo ITS accessions as top hits. Alignment length was 162 bp for ITS1, 221 bp (including a 15 bp indel in some species) for 5.8S, and 356 bp for ITS2. Many Euchusquea clade ITS sequences are identical and the variation that is present in the ITS dataset is concentrated in deep branches of the tree. Five species (C. andina Phil., C. culeou, C. leonardiorum L. G. Clark, C. liebmannii E. Fourn., and C. pinifolia) have large deletions in ITS (spanning all three regions) ranging from 121 bp in C. andina and C. culeou to 613 bp in C. liebmannii. These five sequences were removed from the alignment before phylogenetic analyses to reduce potential error associated with homology uncertainty. Several characteristics of the Chusquea ITS sequences analyzed in this study suggest that they are not pseudogenes (Feliner and Rosselló 2007). Specifically, i) the Chusquea ITS1 spacer was found to contain a conserved sequence motif with AAGGAA 30 of a hairpin structure, ii) an AAGAA loop and an EcoRV site (GATATC; 283–287 bp) are conserved in the 5.8S gene, and iii) several ITS2 RNA sequence folding structures estimated in Mfold show universally conserved pyrimidine mismatches (Zuker 2003). There is no obvious indication that paralogous or pseudogenized ITS sequences SYSTEMATIC BOTANY are present in the alignment, particularly because of the overall lack of observed sequence variation. Neighbor-net networks were used to evaluate character conflict and the combinability of chloroplast data (Suppl. 2). Except for the trnT-trnL and trnD-trnT intergenic spacers, networks for each region suggest a similar pattern in the data, which is largely tree-like but lacking general resolution. The trnT-trnL network includes a large reticulation caused by a 13 base sequence of undetermined origin that is shared by C. gracilis McClure & L. B. Sm. and C. aristata. The region in the alignment containing this ambiguous sequence was excluded in phylogenetic analyses. The trnD-trnT network found a welldefined split between two groups of Chusquea species (Suppl. 2) although this split is supported by only six characters. Tree Estimation—The AIC and dLRT model choice methods agree on adequate models for each dataset from [Volume 39 our candidate pool (Suppl. 3). GTR + I + G was estimated as one of the best-fit models (D £ 2) for all regions except ITS. Less complex nucleotide substitution rate categories are adequate for the ITS dataset (TrN or TIM + I + G). A BI consensus tree was summarized from 10,001 trees after a burn-in of 20 million generations (Fig. 2) and effective sample sizes were found to be adequate in Tracer for the combined BI runs (> 200 samples, as recommended by Drummond and Rambaut (2007)). The posterior distribution appeared to reach convergence after 4.4 million MCMC iterations as indicated by the average standard deviation of split frequencies reaching a value < 0.01 and the stability of likelihood values. ML analysis of the combined chloroplast data resulted in a topology with -lnL = 14,152.99. ML and MP bootstrap support (BS) values are lower than BI posterior probability values on all branches (Fig. 2). Reports of support Fig. 2. Bayesian inference cladogram of combined chloroplast data including support values (maximum parsimony faststep bootstrap/maximum parsimony single tree bootstrap above the branch and maximum likelihood bootstrap/Bayesian posterior probability below the branch). 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA for relationships in the following paragraphs are not meant to reflect total evidence for branches (i.e. branches reported as strongly supported may not be clear in network analyses or supported by SH tests), but are based on BI posterior probability (PP) and MP/ML BS values. The combined chloroplast data recovered many clades with consistent species compositions in BI, ML, and MP phylogeny estimations (Fig. 2). The tree is rooted with Rhipidocladum harmonicum, making Guadua angustifolia sister to Otatea acuminata. Subgenus Magnifoliae and subg. Platonia are the two earliest-diverging clades. Subgenus Rettbergia is monophyletic and sister to a large Euchusquea clade. Branches leading to some clades within Euchusquea change position along the tree backbone depending upon phylogenetic estimation method (Fig. 3). The major clades in a BI analysis of the ITS nuclear region (Fig. 4) correspond to those found in the chloroplast analyses (Fig. 3). The ITS topology is not as resolved as the chloroplast estimate, but it does contain several small groupings that are also found in the chloroplast tree. Sampled Euchusquea species form a monophyletic group in chloroplast phylogeny estimations (Fig. 3). Delineating relationships within Euchusquea is difficult, however, due to low variation among nucleotide sequences. Short branches and poorly supported branching order among Euchusquea lineages creates a polytomy at the base of the clade (Fig. 3). Five Euchusquea clades appear in all BI, ML, and MP topologies with relatively high branch support. These five clades do not agree with the taxonomic groupings within Chusquea. Instead, the chloroplast signal suggests strong geographic partitioning of Euchusquea species relationships. The five supported Euchusquea clades are described here in terms of their species compositions as well as their distributions. Fig. 3. Bayesian inference phylogram of a partitioned analysis of the chloroplast data. Weighted branches indicate maximum likelihood bootstrap support > 90 and Bayesian inference posterior probability support > 0.95. Dashed-line branches change position in maximum likelihood or maximum parsimony analyses. Sw and Ch indicate the species is classified as subg. Swallenochloa or subg. Chusquea, respectively. Chusquea longispiculata, C. leptophylla, C. lorentziana, C. gracilis, and C. abietifolia are not currently placed in a subgenus. Numbered clades are referenced in the text. Chusquea contains four major lineages: subg. Platonia (Neurolepis I), subg. Magnifoliae (Neurolepis II), subg. Rettbergia, and a Euchusquea clade. Within Euchusquea there are five well supported lineages, I-V. Shapes at the end of branches correspond to geographic distribution areas as indicated on the map. Illustrated species are indicated with asterisks. Chusquea maculata and C. exasperata are members of subg. Chusquea sect. Longiprophyllae and are morphologically similar, yet they are not closely related in the tree topology. Their closest relatives according to chloroplast data are shown for comparison. Line drawing of C. serpens is reproduced from Clark 1985; C. maclurei is from Clark 1986; C. maculata and C. exasperata are from Clark 1990. SYSTEMATIC BOTANY [Volume 39 Fig. 4. ITS Bayesian phylogram (left) and cladogram (right). Scale-bar on phylogram is 0.01 changes. Support values are listed as maximum parsimony bootstrap above the branch; maximum likelihood bootstrap/Bayesian posterior probability below the branch. Lettered nodes are referenced in the text. I. CHUSQUEA CULEOU CLADE: AUSTRAL ANDES—A C. culeou clade was recovered in chloroplast analyses with strong support (I, Fig. 3; 93% ML BS, 1.00 PP) and contains species restricted to austral Andean montane forests (Triplett and Clark 2003). C. andina, C. cumingii Nees, and C. quila Kunth form a well-supported group and C. gigantea Demoly + C. uliginosa Phil. is also supported (88% ML BS, 1.00 PP). The widely distributed C. culeou appears to be sister to the rest of this clade. II. CHUSQUEA RAMOSISSIMA CLADE: PARAGUAY, URUGUAY, BRAZIL, ARGENTINA—The C. ramosissima clade consists of C. ramosissima Lindm., C. tenella Nees, and C. longispiculata L. G. Clark and is moderately supported as monophyletic (II, Fig. 3; 90% ML BS, 1.00 PP). Chusquea ramosissima is sister to C. tenella with strong support. Chusquea ramosissima and C. tenella are widespread species in low elevation areas of Paraguay, Uruguay, eastern Brazil, and the state of Misiones, Argentina, while C. longispiculata is restricted to southeastern Brazil. III. CHUSQUEA UNIFLORA CLADE: NORTHERN ANDES AND CENTRAL AMERICA—The C. uniflora clade is composed of species found in low to middle elevation montane and cloud forests in the northern Andes, along with C. scabra Soderstr. & C. E. Calderón, a low elevation species from Costa Rica. There is strong support for monophyly (III, Fig. 3; 96% ML BS, 1.00 PP), but relationships within the clade are unclear, with BI, ML, and MP bootstrap topologies recovering distinct relationships. IV. CHUSQUEA SERPENS CLADE: NORTHERN AND CENTRAL ANDES, CENTRAL AMERICA—The C. serpens clade is well supported 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA (IV, Fig. 3; 98% ML BS, 1.00 PP) and contains four species, C. patens L. G. Clark, C. pohlii L. G. Clark, C. serpens L. G. Clark, and C. maculata L. G. Clark. Chusquea pohlii and C. patens are restricted to Costa Rica and Panama. Chusquea maculata is found only in Colombia and Venezuela, while C. serpens is distributed through those countries, as well as Ecuador. V. CHUSQUEA SCANDENS CLADE: NORTHERN AND CENTRAL ANDES, CENTRAL AMERICA—The C. scandens clade is strongly supported with chloroplast data (V, Fig. 3; 95% ML BS, 1.00 PP) and includes 21 species in BI, ML, and MP analyses. There are several relationships within the C. scandens clade with some branch support in chloroplast analyses. The only strongly supported sister relationship exists between C. foliosa L. G. Clark + C. longifolia Swallen. Many species in the C. scandens clade (e.g. C. leonardiorum and C. subtessellata) are found in high-elevation habitats such as cloud forest, subpáramo, and páramo (Soderstrom and Calderón 1978b; Clark 1992). This group is mainly northern Andean, with a more recently diverging group of Central American species. Several of the Central American species are also found in southern Mexico (C. foliosa and C. longifolia), and C. lorentziana Griseb. from northern Argentina and Bolivia also appears in this clade in all chloroplast analyses (although an SH test cannot reject the possibility that it is a member of the C. culeou clade; see below). In the ITS topology a group of six species from the chloroplast C. scandens clade are recovered as monophyletic with weak support (E, Fig. 4). Within this clade there are supported relationships between C. subtessellata + C. talamancensis and C. costaricensis, C. paludicola, C. tonduzii and C. vulcanalis. Alternative Hypothesis Testing—The possibility that morphologically defined taxonomic groups might be supported by the chloroplast data given the best-fit model was investigated with a series of two-tree comparison SH tests. The SH test rejected most alternative hypotheses with three exceptions: monophyletic constraint of subg. Chusquea sect. Longiprophyllae, subg. Swallenochloa C. culeou group, and subg. Swallenochloa C. nudiramea group (Table 3). These Table 3. Results of two-tree SH tests comparing the maximum likelihood estimate tree with alternative topology hypotheses as described in the text. Chloroplast data was used, unless ITS data is indicated. The sampling column refers to the number of species sampled in this study out of the total number of species in the group. Hypothesis of monophyly Species sampled SH test p value subg. Rettbergia + C. ramosissima subg. Swallenochloa subg. Swallenochloa sect. Swallenochloa subg. Chusquea sect. Longifoliae subg. Chusquea sect. Serpentes subg. Chusquea sect. Verticillatae subg. Chusquea sect. Chusquea subg. Swallenochloa C. culeou group subg. Swallenochloa C. nudiramea group subg. Chusquea sect. Longiprophyllae Brazilian Euchusquea species ITS data subg. Swallenochloa sect. Swallenochloa austral Andean species Brazilian species northern Andean species Central American species 7/13 21/38 14/29 8/11 4/6 7/18 8/19 3/3 3/4 2/6 NA 10/29 NA NA NA NA 0.024* 0.000* 0.000* 0.000* 0.028* 0.007* 0.000* 0.378 0.303 0.182 0.675 0.060 0.057 0.000* 0.000* 0.000* taxonomic groups contain a small number of species or were sparsely sampled in this study, as in the case of sect. Longiprophyllae. An SH test rejected a constrained topology containing a monophyletic subg. Swallenochloa sect. Swallenochloa as an alternative to the unconstrained MLE topology (p = 0.000*). The sampled species of subg. Swallenochloa sect. Swallenochloa are not monophyletic in any of the chloroplast optimal topologies. However, an SH test with the ITS data and the best-fit model failed to reject a topology constraining a group of ten sect. Swallenochloa species as monophyletic (p = 0.06), although we note again the low level of character variation present in the ITS data set. Hypotheses of relationships predicted by geographic proximity were also tested. The C. culeou clade is composed of all sampled taxa from high-elevation habitats and western slopes of the austral Andes. C. ramosissima and C. tenella are mainly found in southeastern Brazil, but extend slightly into Argentina and Paraguay. An SH test failed to reject a topology containing a monophyletic C. culeou clade + C. lorentziana + C. ramosissima + C. tenella (p = 0.057). Another SH test assessed the three Brazilian clades in the chloroplast topology: subg. Rettbergia, except C. arachniformis (known only from the northern Andes), the C. leptophylla clade, and the C. ramosissima clade. Given the chloroplast data and the model, an SH test rejected a topology in which all of the Brazilian species are monophyletic (p = 0.000*). A second SH test of Brazilian species that excluded subg. Rettbergia failed to reject the possibility of a topology containing a monophyletic Brazilian clade (p = 0.675). An SH test of a topology constraining northern Andean taxa to monophyly (species present in subg. Rettbergia, C. uniflora, C. serpens, and C. scandens clades in the chloroplast topology) is rejected given the data and the model (p = 0.000*). Finally, nineteen Central American species are present in the C. pittieri, C. uniflora, C. serpens, and C. scandens clades in the chloroplast topology and an SH test rejected a topology that constrained these groups to be monophyletic (p = 0.000*). Isolation by distance—Comparisons of genetic distances to the proximity of collected individuals were conducted on two groups of Chusquea species: (i) subg. Rettbergia + Euchusquea (Fig. 5A) and (ii) the Euchusquea clade (Fig. 5B). In both analyses there is no apparent relationship between genetic distance and the location of any two individuals. Genetically similar species might be found in the same location (C. talamancensis and C. paludicola, p distance = 0, physical distance = 0) or > 6,000 km apart (C. ramosissima and C. bilimekii, p distance = 0.001, physical distance = 6,943 km). Species that are genetically less similar to one another might also be in the same location (C. virgata and C. longifolia, p distance = 0.01, physical distance = 67 km) or they might be distant (C. nudiramea and C. muelleri, p distance = 0.012, physical distance = 7,350 km). Across the complete dataset, two distinct patterns are seen: large genetic distances between the Euchusquea and subg. Rettbergia species and small genetic distances within Euchusquea. Discussion Our study recovered four major lineages in Chusquea with strong support (Fig. 3). A monophyletic Chusquea includes subg. Magnifoliae (Neurolepis II) sister to subg. Platonia SYSTEMATIC BOTANY Fig. 5. Isolation by distance analyses comparing chloroplast genetic distance on the x axis with physical distance of accessions sampled in this study on the y axis for A) species in Euchusquea and subg. Rettbergia and B) Euchusquea species only. (Neurolepis I) + (subg. Rettbergia + Euchusquea). Relationships among the four lineages corroborate those recovered by Kelchner and Clark (1997), Clark et al. (2007), and Fisher et al. (2009). The ITS nuclear dataset shows little variation (Fig. 4), but is consistent with the chloroplast dataset in resolving the four major Chusquea lineages. We recovered five supported lineages in the Euchusquea clade (Fig. 3) and chloroplast species relationships within Euchusquea correspond to some degree with geographic areas, although the pattern is complicated by more than one Chusquea lineage present in most geographic regions (i.e. northern Andes, Central America, Brazil, possibly the austral Andes). Given geographic patterns, low variation in Euchusquea, and conflicts between molecular and morphological hypotheses of relationships, the data suggest that Chusquea may be a young and actively radiating group of bamboos. Several limitations of the study prevent unambiguous interpretation of the data and leave many relationships unresolved. The chloroplast data contains little variation compared to similar sized datasets for other grass genera, a common problem in bamboo molecular phylogeny studies (Triplett and Clark 2010; Yang et al. 2010). The limited molecular variation may be causing problems with analyses (i.e. tree topology estimation, branch support values, SH tests, isolation by distance) by introducing sampling error. Additionally, the ITS data should be viewed as exploratory because amplicons were not cloned and the sequences exhibit low levels of sequence variation. Supported Lineages—Subgenus Rettbergia is a well-supported lineage that is primarily distributed in Brazil but also includes the northern Andean C. arachniformis. This species was only recently described from Colombia (Clark and Londoño 1998) and exhibits the infravaginal branching, spatheate capitate inflorescences, and connate lemma tips characteristic of subg. Rettbergia species. Kelchner and Clark (1997) sampled the rpl16 intron for this species (as Chusquea [Volume 39 sp. A) and placed it well within the subg. Rettbergia clade. Several other Chusquea species were included in subg. Rettbergia until recently: C. anelythra Nees, C. anelytroides Rupr. ex Döll, C. barbata L. G. Clark, C. pallida Munro, C. ramosissima, C. tenuiglumis Döll, and C. wilkesii Munro (Clark 1993; Judziewicz et al. 1999). This study sampled C. ramosissima and found no support for its inclusion in subg. Rettbergia in combined chloroplast MP, MLE, or BI trees, and an SH test rejected inclusion of this taxon in the subgenus. Chusquea ramosissima was also found to be more closely related to Euchusquea than subg. Rettbergia in a parsimony analysis of rpl16 intron data (Kelchner and Clark 1997, Clark et al. 2007), but this result is contradicted by results of a morphological analysis (Clark et al. 2007) and also of analysis of the trnD-trnT intergenic spacer (data not shown). In this study, Euchusquea is monophyletic, but expands to include members of the polyphyletic subg. Swallenochloa and subg. Chusquea. This finding corroborates other evidence for Euchusquea monophyly (Kelchner and Clark 1997; Clark et al. 2007; Fisher et al. 2009), supports Clark’s (1989) inclusion of Swallenochloa within Chusquea, and supports Clark’s (1997) hypothesis of a close relationship between subg. Chusquea and subg. Swallenochloa. Potentially, the Euchusquea clade could be designated a subgenus as it is supported as monophyletic by molecular data; there are, however, no obvious morphological synapomorphies for the clade (Clark 1997). Relatively dense species sampling allowed us to detect a number of clades within the Euchusquea clade that were robust to changes in methodological framework and corroborate relationships found in other studies. Chloroplast data supports the C. culeou clade (I, Fig. 3) as a monophyletic lineage in Chusquea although species in this clade are morphologically different. Most of the species of Chusquea found in Chile have extravaginal branching and are classified in subg. Chusquea sect. Chusquea. They are represented here by C. quila and C. uliginosa. A single species in Argentina (C. deficiens) exhibits characteristics that place it in sect. Verticillatae, but it was not sampled in this study. The high-elevation C. montana is found in both Argentina and Chile and is a shrubby member of subg. Swallenochloa sect. Swallenochloa. Other austral Andean members of subg. Swallenochloa are C. culeou, C. gigantea, and C. andina (the C. culeou group); they exhibit overlapping variation in overall height and branch dimorphism, which is considered to be a result of elevation, latitude, and shade effects (Veblen 1982; Pearson et al. 1994; Triplett and Clark 2003). Both Kelchner and Clark (1997) and Clark et al. (2007) sampled C. ramosissima, but neither study was able to resolve its placement beyond inclusion in the Euchusquea clade. Our results corroborate the exclusion of C. ramosissima from subg. Rettbergia and instead suggest a close relationship with the sympatric C. tenella (II, Fig. 3). Both C. tenella and C. ramosissima exhibit a pseudopetiolate culm leaf blade that often remains green after the plant has reached maturity. They share this trait with C. tenuiglumis (not sampled). Species in the C. uniflora clade (III, Fig. 3) are from lowelevation montane or cloud forest habitats in the northern Andes and Central America and are classified in subg. Chusquea sect. Verticillatae, sect. Longifoliae, sect. Longiprophyllae, and subg. Swallenochloa sect. Swallenochloa. This clade has been sampled in previous studies (represented by C. exasperata; 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA Kelchner and Clark 1997; Clark et al. 2007), but its position within Euchusquea has not been resolved. The C. serpens clade (IV, Fig. 3) contains species from the northern Andes and Central America that are classified in subg. Chusquea sect. Longiprophyllae, sect. Longifoliae, and sect. Serpentes. There is strong support for monophyly of the clade, but no apparent morphological synapomorphy. Chusquea patens and C. pohlii are both found only in Costa Rica and Panama, while C. serpens extends into Colombia, Ecuador, and Venezuela and C. maculata is found in Colombia and Venezuela. Given the relationships of these species in the phylogeny estimation and their distributions, this clade may represent a dispersal of Chusquea from Central America to the Andes. Species in the C. scandens clade (V, Fig. 3) are drawn from subg. Swallenochloa sect. Swallenochloa, subg. Chusquea sect. Chusquea, sect. Longifoliae, sect. Verticillatae, and sect. Serpentes. These species are found in the northern Andes and Central America, with the exception of C. lorentziana (Argentina and Bolivia) and the extended distribution of C. foliosa and C. longifolia into Mexico. The close relationship between C. foliosa and C. longifolia is interesting in that both species are classified in subg. Chusquea sect. Longifoliae and are found in oak cloud forests. The C. scandens clade also contains a group of closely related species with a center of diversity in Costa Rica: C. costaricensis, C. talamancensis, C. tonduzii, C. paludicola, C. vulcanalis, C. foliosa, C. longifolia, C. subtilis, C. tomentosa, and C. subtessellata. Several other interesting relationships are worth discussing, but are in need of further study. This is the first molecular evidence for the placement of C. abietifolia within Euchusquea (Fig. 3). Chusquea abietifolia is the only Chusquea species found in the West Indies (with collections from Jamaica, Hispaniola, Cuba, and Puerto Rico; Tropicos). The BI and ML analyses place it (unsupported) as sister to the C. uniflora group + the remainder of Euchusquea, while the MP analysis places it as sister to the C. uniflora group (unsupported). Chusquea abietifolia’s relationship within Euchusquea might be difficult to estimate due to a long branch (13 changes in this dataset) distinguishing it from the Euchusquea backbone. Our analysis also recovered an unsupported group of Chusquea species that are primarily found in Brazil (Fig. 3). Resolution within this group is also unsupported and is limited to a sister relationship between C. nudiramea L. G. Clark and C. windischii L. G. Clark and a lineage containing C. gracilis, C. juergensii Hack., C. leptophylla Nees, C. mimosa McClure & L. B. Sm., and C. pinifolia. The majority of these species are restricted to the South Atlantic forest (Espı́rito Santo to southern Santa Catarina), although C. leptophylla also occurs in Minas Gerais (Tropicos). C. juergensii, C. mimosa, and C. pinifolia are fairly widely distributed, while C. nudiramea, C. windischii, and C. microphylla are narrow endemics (Clark 1997). Three species in this group (C. pinifolia, C. windischii, and C. microphylla) are found in campos de altitude habitats (Clark 1992). Chusquea juergensii and C. mimosa australis are often associated with Araucaria formations. Chusquea Evolution—One explanation for the small amount of variation found in Euchusquea chloroplast and nuclear sequences is that Chusquea exhibits slow evolutionary rates, possibly compounded by long generation times (Wilson et al. 1990; Gaut et al. 1997). Yet, chloroplast substitution rates in Chusquea are faster than those seen in most bamboo lineages, with the exception of the herbaceous bamboos (Kelchner and Bamboo Phylogeny Group 2013). Low sequence variation within Euchusquea may also stem from recent origin of the clade and a lack of time to incur substitutions (Ruiz-Sanchez 2011). We prefer a recent origin explanation based on the small amounts of variation found in both the chloroplast and ITS datasets and the geographic patterning of Euchusquea species. If species in Euchusquea are actively radiating, then our molecular datasets might be complicated by processes that are common in recently diverged lineages, including incomplete lineage sorting and hybridization that result in chloroplast sharing. Hybridization and incomplete lineage sorting have been discussed in many phylogenetic studies (Maddison and Knowles 2006; Rokas and Carroll 2006; Holland et al. 2008; Degnan and Rosenberg 2009; King and Roalson 2009; Polihronakis 2010) because these non-treelike processes of genetic inheritance can result in erroneous inferences about the evolution of a group when tree diagrams are used for such data in phylogenetic analyses (Huson and Bryant 2006; Bapteste et al. 2013). These processes could lead to a case where tree-based estimates of DNA phylogeny do not predict morphology. This might be occurring in Euchusquea, where the chloroplast topology contradicts the current taxonomic classification based on hypotheses of morphological evolution (although morphological characters may also evolve in a manner that leads to a homoplasious interpretation of phylogeny). For example, the sampled species in subg. Chusquea sect. Longiprophyllae have prophylls as long as 10 cm, buds arranged in a tight circle at the node, relatively narrow, lanceolate leaf blades, and a first glume that is twice as long as the second glume (Fig. 3, Clark 1990); but the two species of sect. Longiprophyllae sampled in this study (C. maculata and C. exasperata) are not sister. Instead, our chloroplast DNA topology places C. maculata as sister to C. serpens, a species with no elongation of the prophyll, buds arranged in a crescent at the node, wide leaves, and subequal lower glumes. Chusquea exasperata is closely related to C. maclurei L. G. Clark and C. scabra according to our chloroplast estimate, although the three species are different from each other in branching pattern and leaf shape. In another example of conflict between the chloroplast topology and the taxonomic classification of Chusquea, 16 species of subg. Chusquea sect. Verticillatae exhibit distinctive thin leaf blades, dorsally compressed spikelets, reduced first and second glumes, and often a verticillate arrangement of buds (Fig. 1, Soderstrom and Calderón 1978a; Clark 1989). In our analysis of chloroplast data, the sampled members of sect. Verticillatae are recovered in several different Euchusquea clades and an SH test rejects a topology that constrains these species to monophyly. Hybridization has not often been implicated as an important process in bamboo evolution because of the infrequent flowering of most bamboo species (Clark et al. 1989). Bamboos exhibit gregarious monocarpy, a reproductive strategy known as semelparous, hapaxanthic, or plietesial in other plant groups. Bamboos with this life cycle might remain vegetative for decades before a flowering event occurs (Janzen 1974) and the asynchronous nature of flowering among bamboo species is expected to decrease the potential for hybridization. Recent molecular work, however, has shown that hybridization was involved in the formation SYSTEMATIC BOTANY of temperate bamboo species in the genera Hibanobambusa Maruy. & H. Okamura, Sasa Makino & Shibata, Sasamorpha Nakai, and Pleioblastus Nakai (Triplett and Clark 2010). Hybridization also seems to occur among species in Arundinaria Michx. (Triplett et al. 2010) and Chimonocalamus (Yang et al. 2013) and likely occurs among the Paleotropical bamboos as well (Goh et al. 2011; Wong and Low 2011). Within Chusquea, hybridization appears to have occurred between frequently flowering species of subg. Swallenochloa sect. Swallenochloa (Clark et al. 1989; Pohl 1991). Clark et al. (1989) identified morphologically intermediate plants hypothesized to represent C. amistadensis L. G. Clark, Davidse & R. P. Ellis x C. subtessellata and C. vulcanalis x C. subtessellata in several populations in Panama and Costa Rica and C. spencei x C. tessellata in Colombian populations. Based on low nucleotide sequence variation within Euchusquea, the presence of morphological intermediates, a large number of sympatric species in Central America and the northern Andes, frequent flowering of some high-elevation species, and the conflict between molecular and morphological based estimates of relatedness, hybridization between Euchusquea species is likely to occur more than previously thought, and merits further investigation. The Chusquea ITS tree topology (Fig. 4) is not based on cloned sequences which unfortunately restricts our ability to test hypotheses of hybridization in Euchusquea in this study. Although hybridization probably occurs between some Euchusquea species, incomplete lineage sorting might also affect tree-based chloroplast and nuclear phylogenetic estimates in Chusquea. Incomplete lineage sorting occurs during the divergence of nascent species when descendent populations retain multiple ancestral haplotypes before alleles coalesce to a single haplotype (Maddison 1997). Although several studies have identified coalescent-based approaches to investigate the effects of incomplete lineage sorting on phylogeny estimations of closely related species (Maddison and Knowles 2006; Carstens and Knowles 2007; King and Roalson 2009; Polihronakis 2010), the current Chusquea dataset does not include adequate independent loci nor the population level sampling necessary to use these approaches effectively. If the common ancestor of Euchusquea contained polymorphisms that have not yet had time to fix in diverging lineages, then one would expect to see a random pattern of ancestral haplotypes in progeny species (Comes and Abbott 2001; Maddison and Knowles 2006), with no morphological or geographic signal (Morando et al. 2004; Jabaily and Sytsma 2010). Chloroplast genetic relationships among Euchusquea species seem to be largely unlinked from morphological traits and a test of isolation by distance did not uncover a simple pattern between chloroplast genetic relatedness and geographic distance (Fig. 5). There are apparent geographic patterns in Euchusquea chloroplast relationships, but those patterns are complicated by multiple lineages co-occurring geographically. Since Euchusquea may have recently undergone a species radiation or may be radiating at present, it is reasonable to infer that incomplete lineage sorting can partly explain the observed incongruence between chloroplast and morphological hypotheses of relationships. Contrasting with results of the isolation by distance analysis, the phylogeny estimation for Euchusquea shows a pattern of chloroplast lineages that correspond to geographic distribution. Considering the pattern present in the chloroplast analysis, it is possible that gene flow among Euchusquea species [Volume 39 within a geographical region led to chloroplast sharing and development of a regional chloroplast signal. There are few supported relationships within clades (Fig. 3) and it is therefore possible that chloroplasts in extant Euchusquea have not completed lineage sorting at the level of morphologically distinguishable species, but instead retain polymorphisms that are shared with other species in their geographic area. The geographic signal in the Euchusquea is most likely due to a combination of the effects of a recent radiation of Euchusquea species, incomplete lineage sorting, and hybridization-mediated chloroplast sharing. Euchusquea is probably a young group that is actively radiating in several geographic areas, particularly the northern Andes, Central America, and southeastern Brazil and reproductive isolation barriers may be weak or non-existent. Implications for Taxonomy—Species in Chusquea have previously been placed in three subgenera, numerous sections, and informal groups based on unique combinations of morphological characters. Molecular evidence supports the existence of a monophyletic subg. Rettbergia, a Euchusquea clade containing polyphyletic subg. Swallenochloa and subg. Chusquea, and two early-diverging clades comprised of species formerly in the genus Neurolepis that have been informally referred to as Neurolepis I and Neurolepis II. Chloroplast data suggest a consistent pattern of lineages within Euchusquea, but most of these lineages are not strongly supported and alternative sets of relationships, including morphologically defined taxonomic groups, cannot be ruled out by SH tests. In addition, Euchusquea chloroplast lineages lack obvious morphological synapomorphies that would serve in a new subgeneric or sectional classification. There remains a need to organize and reference the large amount of morphological variation present in Euchusquea for floristic, systematic, ecological, and physiological studies (Bortolus 2008). Until there is compelling evidence for the existence of evolutionary lineages that are also morphologically definable, we propose that maintaining the current subgeneric classification is the most practical and biologically relevant course in Euchusquea, with the caveat that subg. Chusquea and subg. Swallenochloa appear to be polyphyletic with chloroplast data. In contrast to the lineages of the Euchusquea clade, earlydiverging lineages of Chusquea represent well-supported primary divisions within the genus and several potential morphological synapomorphies have been identified. We propose elevating the Neurolepis I and Neurolepis II clades to subgeneric rank. Symplesiomorphies for the Neurolepis clades are a lack of aerial branching (an unusual character shared by only two other woody bamboo genera, Glaziophyton Franchet and Greslania Balansa) and inner ligules with evident nerves (Judziewicz et al. 1999). Morphological differences distinguishing the Neurolepis clades were identified in Fisher et al. (2009), but the large-leaved C. nobilis was in a seemingly incongruous placement in the otherwise smallleaved Neurolepis I clade. After re-examination, C. nobilis has been found to exhibit characters such as awned glumes that are consistent with Neurolepis I species, with the exception of its large leaves. The only previously published subgeneric name for Neurolepis is subg. Platonia (Kunth) Nees. Nees von Esenbeck (1835) created subg. Platonia on the occasion of submerging Platonia Kunth (a basionym of Neurolepis and a later homonym of Platonia Mart.) and other bamboo genera with one-flowered spikelets in Chusquea. Following Kunth’s concept, the type 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA of subg. Platonia (Kunth) Nees is C. elata, a species resolved within the Neurolepis I clade in the analyses of Fisher et al. (2009). Therefore, subg. Platonia follows C. elata and is the correct name of the Neurolepis I clade at the subgenus level. As there are no additional subgeneric names for these clades, Chusquea subg. Magnifoliae is published here as a subgenus novum. The epithet describes the large leaves characteristic of species in the Neurolepis II clade and correspondingly, C. magnifolia L. G. Clark is the type species. The descriptions below follow Fisher et al. (2009), with the addition of a distinguishing reproductive character (presence or absence of awned glumes). Chusquea subgenus Platonia Fisher & L. G. Clark, nom. et stat. nov. Platonia Kunth, Rev. Gram 1: 139. 1829., non Raf. (1810), nec Mart. (1832).—TYPE: P. elata Kunth. Neurolepis Meisner, Pl. Vasc. Gen. 1: 426. 1843.—TYPE: N. elata (Kunth) Pilg. Internodes 1–14 cm long, solid or hollow. Culm leaves poorly or not differentiated. Bud complement, if developed, consisting of a single bud triangular in outline and oriented vertically. Aerial branching absent. Foliage leaf blades usually 8–164(-180) cm long and (0.6-)1–6.3(-8.3) cm wide but 162–300(-400) cm long and 3.5–10(-12) cm wide in C. nobilis; pseudopetioles absent to short (1–6 mm long), but 1.5–17.5 cm in C. asymmetrica. Glumes usually with well developed awns, sometimes acuminate to subulate. Lemma with apex free. Chusquea acuminatissima (Munro) L. G. Clark, C. aristata Munro, C. asymmetrica (L. G. Clark) L. G. Clark, C. elata (Kunth) L. G. Clark, C. fimbriligulata (L. G. Clark) L. G. Clark, C. laegaardii (L. G. Clark) L. G. Clark, C. nana (L. G. Clark), L. G. Clark, C. nobilis (Munro) L. G. Clark, C. rigida (L. G. Clark) L. G. Clark, C. stuebelii (Pilg.) L. G. Clark, C. villosa (L. G. Clark) L. G. Clark. Chusquea subgenus Magnifoliae L. G. Clark & Fisher, subg. nov.—TYPE: Chusquea magnifolia L. G. Clark. Internodes 1–3 cm long, solid. Culm leaves poorly or not differentiated. Bud complement, if developed, consisting of a single bud triangular in outline and oriented vertically. Aerial branching absent. Foliage leaf blades (20-)30 – 300 (-377) cm long and 1.2 – 24(-30) cm wide; pseudopetioles well developed; lacking blade tissue, (1-)3– 50 cm long. Glumes usually lacking awns. Lemma with apex free. C. angusta (Swallen) L. G. Clark, C. cylindrica L. G. Clark, C. diversiglumis (Soderstr.) L. G. Clark, C. glomerata (Swallen) Dorr, C. magnifolia L. G. Clark, C. mollis (Swallen) L. G. Clark, C. petiolata (Davidse & L. G. Clark) L. G. Clark, C. silverstonei (Davidse & L. G. Clark) L. G. Clark, C. spectabilis L. G. Clark, C. tovari L. G. Clark. Acknowledgments. This research was completed as a partial fulfillment of a doctoral dissertation by Fisher at Idaho State University. Funding for research supplies and sequencing was primarily through NSF Grant DEB-0515818 to Kelchner and additional funding was provided by the Idaho State University Molecular Research Core Facility and NSF Grant DEB-0515712 to Clark. This work would not have been completed without the help of the staff of the Costa Rica National Museum and INBio, specifically Nelson Zamora and Alvaro Herrera, for assistance with permits, access to herbaria, and logistical help in the field. Chris Tyrrell collaborated on fieldwork and Mayra Montiel Longhi gave logistical support in Costa Rica. Fieldwork in Costa Rica (2008) by Fisher and Clark was supported by NSF Grant DEB-0515818 to Kelchner and DEB-0515712 to Clark, respectively. Rusty Russell and Paul Peterson facilitated Fisher’s access to Chusquea specimens at US. Jimmy Triplett, Chris Tyrrell, Amy Denton, and staff at the Idaho State University Molecular Research Core Facility offered important advice on molecular protocols. Idaho State University undergraduates Alexandra Meier, Wendy Newbold, Tsedey Kassaye, and Blackfoot High School (Blackfoot, Idaho) student Paige Casperson assisted Fisher with labwork related to this project. Lucinda McDade and committee members Nancy Huntly and Michael Thomas made helpful comments on earlier drafts of the manuscript. Literature Cited Alvarez, I. and J. F. Wendel. 2003. Ribosomal ITS sequences and plant phylogenetic inference. Molecular Phylogenetics and Evolution 29: 417–434. Bapteste, E., L. van Iersel, A. Janke, S. Kelchner, S. Kelk, J. O. McInerney, D. A. Morrison, L. Nakhleh, M. Steel, and L. Stougie. 2013. Networks: Expanding evolutionary thinking. Trends in Genetics 29: 439–441. Borsch, T., K. W. Hilu, D. Quandt, V. Wilde, C. Neinhuis, and W. Barthlott. 2003. Noncoding plastid trnT-trnF sequences reveal a well resolved phylogeny of basal angiosperms. Journal of Evolutionary Biology 16: 558–576. Bortolus, A. 2008. Error cascades in the biological sciences: the unwanted consequences of using bad taxonomy in ecology. AMBIO: A Journal of the Human Environment 37: 114–118. Carstens, B. C. and L. L. Knowles. 2007. Estimating species phylogeny from gene-tree probabilities despite incomplete lineage sorting: an example from Melanoplus grasshoppers. Systematic Biology 56: 400–411. Clark, L. G. 1989. Systematics of Chusquea section Swallenochloa, section Verticillatae, section Serpentes, and section Longifoliae (PoaceaeBambusoideae). Systematic Botany Monographs 27: 1–127. Clark, L. G. 1990. Chusquea sect. Longiprophyllae (Poaceae: Bambusoideae): A new Andean section and new species. Systematic Botany 15: 617–634. Clark, L. G. 1992. Chusquea sect. Swallenochloa (Poaceae: Bambusoideae) and allies in Brazil. Brittonia 44: 387–422. Clark, L. G. 1993. Five new species of Chusquea (Poaceae: Bambusoideae) and a new combination. Novon 3: 228–238. Clark, L. G. 1996. Six new species of Neurolepis (Poaceae: Bambusoideae: Bambuseae) from Ecuador and Peru. Novon 6: 335–350. Clark, L. G. 1997. Diversity, biogeography and evolution of Chusquea. P. 33–44 in The bamboos. ed. G. P. Chapman. London: Academic Press. Clark, L. G. and X. Londoño. 1998. Eight new taxa and two new reports of Bambuseae (Poaceae: Bambusoideae) from Colombia. Novon 8: 408–428. Clark, L. G., G. Davidse, and R. P. Ellis. 1989. Natural hybridization in bamboos: Evidence from Chusquea sect. Swallenochloa (Poaceae: Bambusoideae). National Geographic Research 5: 459–476. Clark, L. G., S. Dransfield, J. K. Triplett, and J. G. Sanchez-Ken. 2007. Phylogenetic relationships among the one-flowered, determinate genera of Bambuseae (Poaceae: Bambusoideae). Aliso 23: 315–332. Comes, H. P. and R. J. Abbott. 2001. Molecular phylogeography, reticulation, and lineage sorting in Mediterranean Senecio sect. Senecio (Asteraceae). Evolution 55: 1943–1962. Degnan, J. H. and N. A. Rosenberg. 2009. Gene tree discordance, phylogenetic inference and the multispecies coalescent. Trends in Ecology & Evolution 24: 332–340. Demesure, B., N. Sodzi, and R. J. Petit. 1995. A set of universal primers for amplification of polymorphic noncoding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology 4: 129–131. Desvaux, A. N. 1831. Mémoires de la Société d’Agriculture. Sciences et Arts d’Angers 1: 211. Don, R. H., P. T. Cox, B. J. Wainwright, K. Baker, and J. S. Mattick. 1991. ’Touchdown’ PCR to circumvent spurious priming during gene amplification. Nucleic Acids Research 19: 4008. Drummond, A. and A. Rambaut. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7: 214. Ersts, P. J. 2009. Geographic distance matrix generator, v. 1.2.3. New York: American Museum of Natural History, Center for Biodiversity and Conservation. Available from http://biodiversityinformatics.amnh .org/open_source/gdmg. Feliner, G. N. and J. A. Rosselló. 2007. Better the Devil You Know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Molecular Phylogenetics and Evolution 44: 911–919. SYSTEMATIC BOTANY Fisher, A. E., J. K. Triplett, C. S. Ho, A. D. Schiller, K. A. Oltrogge, E. S. Schroder, S. A. Kelchner, and L. G. Clark. 2009. Paraphyly in the bamboo subtribe Chusqueinae (Poaceae: Bambusoideae) and a revised infrageneric classification for Chusquea. Systematic Botany 34: 673–683. Gaut, B. S., L. G. Clark, J. F. Wendel, and S. V. Muse. 1997. Comparisons of the molecular evolutionary process at rbcL and ndhF in the grass family (Poaceae). Molecular Biology and Evolution 14: 769–777. Giordano, C. V., R. A. Sanchez, and A. T. Austin. 2009. Gregarious bamboo flowering opens a window of opportunity for regeneration in a temperate forest in Patagonia. The New Phytologist 181: 880–889. Goh, W. L., S. Chandran, K. Kamiya, and K. M. Wong. 2011. A natural hybrid between Dendrocalamus pendulus and Gigantochloa scortechinii (Poaceae: Bambusoideae: Bambuseae) in Peninsular Malaysia. Gardens’. Bulletin Singapore 62: 223–238. Graham, S. W., P. A. Reeves, A. C. E. Burns, and R. G. Olmstead. 2000. Microstructural changes in noncoding chloroplast DNA: Interpretation, evolution, and utility of indels and inversions in basal Angiosperm phylogenetic inference. International Journal of Plant Sciences 161: S83–S96. Griekspoor, A. and T. Groothuis. 2006. 4Peaks, v. 1.7.2. Nucleobytes.com. Guindon, S. and O. Gascuel. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52: 696–704. Holland, B. R., S. Benthin, P. J. Lockhart, V. Moulton, and K. T. Huber. 2008. Using supernetworks to distinguish hybridization from lineagesorting. BMC Evolutionary Biology 8: 202. Holz, A. C. and T. T. Veblen. 2006. Tree regeneration responses to Chusquea montana bamboo die-off in a subalpine Nothofagus forest in the southern Andes. Journal of Vegetation Science 17: 19–28. Hsiao, C., N. J. Chatterton, K. H. Asay, and K. B. Jensen. 1995. Molecular phylogeny of the Pooideae (Poaceae) based on nuclear rDNA (ITS) sequences. Theoretical and Applied Genetics 90: 389–398. Huelsenbeck, J. P. and F. Ronquist. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17: 754–755. Huelsenbeck, J. P. and B. Rannala. 2004. Frequentist properties of Bayesian posterior probabilities of phylogenetic trees under simple and complex substitution models. Systematic Biology 53: 904–913. Huson, D. H. and D. Bryant. 2006. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 23: 254–267. Jabaily, R. S. and K. J. Sytsma. 2010. Phylogenetics of Puya (Bromeliaceae): Placement, major lineages, and evolution of Chilean species. American Journal of Botany 97: 337–356. Janzen, D. H. 1974. Why bamboos wait so long to flower. Annual Review of Ecology and Systematics 7: 347–391. Judziewicz, E. J., L. G. Clark, X. Londoño, and M. J. Stern. 1999. American bamboos. Washington, D. C.: Smithsonian Institution. Kelchner, S. A. 2000. The evolution of non-coding chloroplast DNA and its application in plant systematics. Annals of the Missouri Botanical Garden 87: 482–498. Kelchner, S. A. 2003. Phylogenetic structure, biogeography, and evolution of the Myoporaceae. Ph. D. thesis, Canberra: The Australian National University. Kelchner, S. A. and L. G. Clark. 1997. Molecular evolution and phylogenetic utility of the chloroplast rpl16 intron in Chusquea and the Bambusoideae (Poaceae). Molecular Phylogenetics and Evolution 8: 385–397. Kelchner, S. A. and Bamboo Phylogeny Group. 2013. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers. Molecular Phylogenetics and Evolution 67: 404. King, M. G. and E. H. Roalson. 2009. Discordance between phylogenetics and coalescent based divergence modelling: exploring phylogeographic patterns of speciation in the Carex macrocephala species complex. Molecular Ecology 18: 468–482. Kunth, K. S. 1816. Pp. 201 in Nova Genera et Species Plantarum 1, Ed. 4, eds. F. W. H. A. Humboldt, A. J. A. Bonpland, and K. S. Kunth. Paris: Graeco-Latino-Germanico. Laegaard, S. 1992. Influence of fire in the grass paramo vegetation of Ecuador. Pp. 151–170 in Paramos: An Andean ecosystem under human influence, ed. H. Balslev and J. L. Luteyn. San Diego, California: Harcourt Brace Jovanovich Publishers. Londoño, X. 1996. Diversity and distribution of new world bamboos, with special emphasis on the Bambuseae. INBAR Working Paper 8. New Delhi: INBAR. Maddison, W. P. 1997. Gene trees in species trees. Systematic Biology 46: 523. [Volume 39 Maddison, W. P. and L. L. Knowles. 2006. Inferring phylogeny despite incomplete lineage sorting. Systematic Biology 55: 21–30. McClure, F. A. 1973. Genera of bamboos native to the new world (Gramineae: Bambusoideae), vol. 9. Washington, D. C.: Smithsonian Institution Press. Morando, M., L. J. Avila, J. Baker, and J. W. J. Sites. 2004. Phylogeny and phylogeography of the Liolaemus darwinii complex (Squamata: Liolaemidae): Evidence for introgression and incomplete lineage sorting. Evolution 58: 842–861. Morrison, D. A. 2010. Using data-display networks for exploratory data analysis in phylogenetic studies. Molecular Biology and Evolution 27: 1044–1057. Mort, M. E., D. E. Soltis, P. S. Soltis, and M. L. Mabry. 2000. Comparison of three methods for estimating internal support on phylogenetic trees. Systematic Biology 49: 160–171. Munro, W. 1868. Monograph of the Bambusaceae. Transactions of the Linnean Society 26: 52–73. Nees von Esenbeck, C. 1835. Bambuseae Brasilienses: Recensuit, et Alias in India Orientali Provenientes Adjecit. Linnaea 33: 1–308. Olmstead, R. G. and J. A. Sweere. 1994. Combining data in phylogenetic systematics: an empirical approach using three molecular data sets in the Solanaceae. Systematic Biology 43: 467–481. Pearson, A. K., O. P. Pearson, and I. Gomez-Gallopin. 1994. Biology of the bamboo Chusquea culeou (Poaceae: Bambusoideae) in southern Argentina. Vegetatio 111: 93–126. Pohl, R. W. 1991. Blooming history of the Costa Rican bamboos. Revista de Biologia Tropical 39: 111–124. Polihronakis, M. 2010. The interface between phylogenetics and population genetics: investigating gene trees, species trees, and population dynamics in the Phyllophaga fraterna species group. Evolution 64: 1048–1062. Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution 25: 1253–1256. Prince, L. and W. Kress. 2006. Phylogeny and biogeography of the prayer plant family: getting to the root problem in Marantaceae. Pp. 645–659 in Monocots: Comparative biology and evolution, ed. J. T. Columbus, E. A. Friar, J. M. Porter, L. Prince, and M. G. Simpson. Claremont, California: Rancho Santa Ana Botanic Garden. Rambaut, A. 2001. Se-Al: Sequence alignment editor, v. 2.0a11. Oxford, U. K.: University of Oxford. Available from: http://tree.bio.ed.ac .uk/software/seal. Rambaut, A. and A. J. Drummond. 2007. Tracer, v. 1.4. Oxford, U. K.: University of Oxford. Available from: http://tree.bio.ed.ac.uk/ software/tracer. Rokas, A. and S. B. Carroll. 2006. Bushes in the tree of life. PLoS Biology 4: e352. Ruiz-Sanchez, E. 2011. Biogeography and divergence time estimates of woody bamboos: Insights in the evolution of the Neotropical bamboos. Boletı́n de la Sociedad Botánica de México 88: 67–75. Safford, H. D. 1999. Brazilian páramos I. An introduction to the physical environment and vegetation of the campos de altitude. Journal of Biogeography 26: 693–712. Shaw, J., E. B. Lickey, E. E. Schilling, and R. L. Small. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. American Journal of Botany 94: 275–288. Shaw, J., E. B. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Siripun, C. T. Winder, E. E. Schilling, and R. L. Small. 2005. The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany 92: 142–166. Shimodaira, H. and M. Hasegawa. 1999. Multiple comparisons of loglikelihoods with applications to phylogenetic inference. Molecular Biology and Evolution 16: 1114–1116. Slatkin, M. 1993. Isolation by distance in equilibrium and non-equilibrium populations. Evolution 47: 264–279. Soderstrom, T. R. and C. E. Calderón. 1978a. The species of Chusquea (Poaceae: Bambusoideae) with verticillate buds. Brittonia 30: 154–164. Soderstrom, T. R. and C. E. Calderón. 1978b. Chusquea and Swallenochloa (Poaceae: Bambusoideae): Generic relationships and new species. Brittonia 30: 297–312. Sullivan, J. 2005. Maximum likelihood methods for phylogeny estimation. Methods in Enzymology 395: 757–779. Sungkaew, S., C. M. Stapleton, N. Salamin, and T. R. Hodkinson. 2009. Non-monophyly of the woody bamboos (Bambuseae; Poaceae): A multi-gene region phylogenetic analysis of Bambusoideae s. s. Journal of Plant Research 122: 95–108. 2014] FISHER ET AL.: PHYLOGENY ESTIMATION OF CHUSQUEA Swofford, D. L. 2003. PAUP* Phylogenetic analysis using parsimony (*and other methods), v. 4.0 beta 10. Sunderland: Sinauer Associates. Taberlet, P., L. Gielly, G. Pautou, and J. Bouvet. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–1109. Tol, G. J. and A. M. Cleef. 1994. Above-ground biomass structure of a Chusquea tessellata bamboo páramo, Chingaza National Park, Cordillera Oriental, Colombia. Vegetatio 115: 29– 39. Triplett, J. K. and L. G. Clark. 2003. Ambiguity and an American bamboo: The Chusquea culeou species complex. Bamboo Science and Culture 17: 21–27. Triplett, J. K. and L. G. Clark. 2010. Phylogeny of the temperate bamboos (Poaceae: Bambusoideae: Bambuseae) with an emphasis on Arundinaria and allies. Systematic Botany 35: 102–120. Triplett, J. K., K. A. Oltrogge, and L. G. Clark. 2010. Phylogenetic relationships and natural hybridization among the North American woody bamboos (Poaceae: Bambusoideae: Arundinaria). American Journal of Botany 97: 471–492. Veblen, T. T. 1982. Growth patterns of Chusquea bamboos in the understory of Chilean Nothofagus forests and their influences in forest dynamics. Bulletin of the Torrey Botanical Club 109: 474–487. Watts, C. D., A. E. Fisher, C. D. Shrum, W. L. Newbold, S. Hansen, C. Liu, and S. A. Kelchner. 2008. The D4 set: Primers that target highly variable intron loops in plant chloroplast genomes. Molecular Ecology Resources 8: 1344–1347. Widmer, Y. 1997. Life history of some Chusquea species in old-growth oak forest in Costa Rica. Pp. 17–31 in The bamboos, ed. G. P. Chapman. London: Linnean Society of London. Wilson, M. A., B. Gaut, and M. T. Clegg. 1990. Chloroplast DNA evolves slowly in the palm family (Arecaceae). Molecular Biology and Evolution 7: 303–314. Wong, K. M. and Y. W. Low. 2011. Hybrid zone characteristics of the intergeneric hybrid bamboo x Gigantocalamus maplenensis (Poaceae: Bambusoideae) in peninsular Malaysia. Gardens’. Bulletin Singapore 63: 375–383. Yang, H. M., Y. X. Zhang, J. B. Yang, and D. Z. Li. 2013. The monophyly of Chimonocalamus and conflicting gene trees in Arundinarieae (Poaceae: Bambusoideae) inferred from four plastid and two nuclear markers. Molecular Phylogenetics and Evolution 68: 340–356. Yang, J. B., H. Q. Yang, D. Z. Li, K. M. Wong, and Y. M. Yang. 2010. Phylogeny of Bambusa and its allies (Poaceae: Bambusoideae) inferred from nuclear GBSSI gene and plastid psbA-trnH, rpl32-trnL and rps16 intron DNA sequences. Taxon 59: 1102–1110. Zhang, W. 2000. Phylogeny of the grass family (Poaceae) from rpl16 intron sequence data. Molecular Phylogenetics and Evolution 15: 135–146. Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31: 3406–3415. Appendix 1. Taxon sampling, voucher information, and GenBank accession information for specimens used in this study. All vouchers are deposited at ISC. The information is listed as: taxon, voucher collection number; GenBank accessions: ndhF gene, rpl16 intron, ndhA intron, trnD-trnT intergenic spacer, trnT-trnL intergenic spacer, and ITS complex (AC = Andre Mauricio Carvalho; AF = Amanda Fisher; EG = Elizabeth Gordon; ER = Eduardo Ruiz; GSK = Gabriel Sánchez-Ken; FZ = Fernando Zuloaga; IM = I. Montecinos; JT = Jimmy Triplett; LC = Lynn Clark; LSS= Luis Sergio Sarahyba; MS = Margaret Stern; PA = Patricio Asimbaya; PT = Pedro Tenorio; PW = Paulo Windisch; SK = Scot Kelchner; SL = Simon Laegaard; WO = Walter de Oliviera; WZ = Weiping Zhang; XL = Ximena Londoño). Rhipidocladum harmonicum (Parodi) McClure. LC & WO 1103; KF945324, KF945624, KF945453, KF945223, KF945387,–. Otatea acuminata (Munro) C. Calderón & Soderstr. LC et al. 1312; AF182350, AF133473, KF945452, FJ751732, KC020559, KF945270. Guadua angustifolia Kunth. LC & XL 931; FJ751641, FJ751664, KF945451, FJ751734, FJ644154, AY993946. Chusquea aristata Munro. LC et al. 1084; FJ751654, AY912196, KF945450, FJ751747, KF945386, KF945268. Chusquea spectabilis L. G. Clark. XL & LC 905; AF182355, U62793, KF945449, FJ751752, KC020550, KF945269. Chusquea abietifolia Griesebach. LC et al. 1509; KF945271, KF945591, KF945388, KF945170, KF945325,–. Chusquea albilanata L. G. Clark & Londoño. LC et al. 1125; KF945272, KF945592, KF945389, KF945171, KF945326, KF945224. Chusquea andina Philippi. LC & ER 980; KF945273, KF945593, KF945390, KF945172, KF945327, KF945225. Chusquea antioquensis L. G. Clark & Londoño. LC & XL 1222; KF945274, U62783, KF945391, KF945173, KF945328, KF945226. Chusquea arachniformis L. G. Clark & Londoño. LC & XL 1228; FJ751646, U62787, KF945392, KF945329, FJ751739,–. Chusquea bambusoides (Raddi) Hack. LC 1029; FJ751649, AY912194, KF945393, FJ751742, KC020548,–. Chusquea bilimekii Fournier. LC et al. 1311; KF945275, U54757, KF945394, KF945174, KF945330,–. Chusquea bradei L. G.Clark. AC 4377; FJ751650, FJ751666, KF945395, FJ751743, KF945331,–. Chusquea coronalis Soderstr. & C. Calderón. SK 19; FJ751642, U54759, KF945396, FJ751735, KF945332, KF945227. Chusquea costaricensis L. G. Clark & R. March. SK 15; KF945276, JQ352318, KF945397, KF945175, KF945333, KF945228. Chusquea culeou Desvaux. LC & ER 976; KF945277, AY912195, KF945398, KF945176, KF945334, KF945229. Chusquea cumingii Nees.— s. n. dried sample; KF945278, KF945596, KF945399, KF945177, KF945335,–. Chusquea exasperata L. G. Clark. LC et al. 1093; KF945279, U62784, KF945597, KF945400, KF945178, KF945336,–. Chusquea aff. fendleri Munro. LC & XL 1220; KF945280, U62780, KF945401, KF945179, KF945337, KF945230. Chusquea foliosa L. G. Clark. AF 31; KF945281, JQ352306, KF945402, KF945180, KF945338, KF945231. Chusquea gigantea Demoly. s. n. Brest, France; KF945282, KF945598, KF945403, KF945181, KF945339, KF945232. Chusquea glauca L. G. Clark. LC et al. 1310; KF945283, KF945599, KF945404, KF945182, KF945340, KF945233. Chusquea gracilis McClure & Smith. LC 1034; KF945284, KF945600, KF945405, KF945183, KF945341, KF945234. Chusquea juergensii Hackel. LC & PW 1067; KF945285, U62792, KF945406, KF945184, KF945342, KF945235. Chusquea latifolia L. G. Clark. LC & XL 417;–,–,–,–,–, AF019788. Chusquea lehmannii Pilger. LC & PA 1386; KF945286, JQ352307, KF945407, KF945185, KF945343, KF945236. Chusquea leonardiorum L. G. Clark. LC et al. 1081; KF945287, JQ352308,–, KF945186, KF945344, KF945237. Chusquea leptophylla Nees. LC & XL 1043; KF945288, KF945602, available on request (<200b), KF945187, KF945345,–. Chusquea liebmannii Fournier. AF 1; KF945289, KF945603, KF945408, KF945188, KF945346, available on request (<200b). Chusquea longifolia Swallen. AF 41; KF945290, JQ352309, KF945409, KF945189, KF945347, KF945238. Chusquea longispiculata L. G. Clark. LC & XL 1026; KF945291, KF945604, KF945410, KF945190, KF945348, KF945239. Chusquea lorentziana Grisebach. LC & FZ 1017; KF945292, JQ352310, KF945411, KF945191, KF945349, KF945240. Chusquea loxensis L. G. Clark. LC et al. 1114; KF945293, JQ352311, KF945412, KF945192, KF945350, KF945241. Chusquea maclurei L. G. Clark. LC & SL 1127; KF945294, KF945605, KF945413, KF945193, KF945351, KF945242. Chusquea maculata L. G. Clark. LC & XL 1226; KF945295, JQ352312, KF945414, KF945194, KF945352, KF945243. Chusquea mayrae Fisher, Tyrrell & L. G. Clark. AF 32;–, JQ352313,–,–,–, KF945244. Chusquea microphylla (Doell in Martius) L. G. Clark. s. n. airdried; KF945296, KF945606, KF945415, KF945195, KF945353,–. Chusquea mimosa subsp. australis L. G. Clark. LC & XL 1040; KF945297, KF945607, KF945416, KF945196, KF945354,–. Chusquea montana R.A. Philippi. LC & ER 993; KF945298, KF945608, KF945417, KF945197, KF945355,–. Chusquea muelleri Munro. LC et al. 1140; KF945299, KF945609, KF945418, KF945198, KF945356,–. Chusquea nudiramea L. G. Clark. LC & PW 1068; KF945300, U62792, KF945419, KF945199, KF945357, KF945245. Chusquea oligophylla Ruprecht. LC & XL 1031; FJ751651, U62785, KF945420, FJ751744, KF945358,–. Chusquea oxylepis (Hack.) Ekman. LC & PW 1069; FJ751647, U62786, KF945421, FJ751740, KF945359, KF945246. Chusquea paludicola L. G. Clark. SK 11; KF945301, JQ352320, KF945422, KF945200, KF945360, KF945247. Chusquea patens L. G. Clark. AF 2; KF945302, JQ352314, KF945423, KF945201, KF945361, KF945248. Chusquea perligulata (Pilger) McClure. LC et al. 1074; KF945303, JQ352315, KF945424, KF945202, KF945362,–. Chusquea perotensis L. G. Clark, Cortés & Cházaro. LC & PT 952; KF945304, KF945611, KF945425, JQ352304, KF945363, KF945249. Chusquea pinifolia (Nees) Nees. LC & PW 1056; KF945305, U54756, KF945426, KF945204, KF945364, KF945250. Chusquea pittieri Hackel. AF 35; KF945306, KF945613, KF945427, KF945205, KF945365, KF945251. Chusquea pohlii L. G. Clark. AF 6; KF945307, JQ352316, KF945428, KF945206, KF945366, KF945252. Chusquea quila Kunth. LC & IM 970; KF945308, KF945614, KF945429, KF945207, KF945367, KF945253. Chusquea ramosissima Lindman. AC 4358; KF945309, AF133472, KF945430, KF945208, KF945368,–. Chusquea robusta L. G. Clark & Losure. LC et al. 1132; KF945310, JQ352317, KF945431, KF945209, KF945369, KF945254. Chusquea scabra Soderstrom & Calderón. AF 10; KF945311, KF945615, KF945432, KF945210, KF945370, KF945255. Chusquea scandens Kunth. LC & XL 1235; FJ751643, U62781, KF945433, FJ751736, KC020549,–. Chusquea serpens L. G.Clark. LC & XL 1253; FJ751645, U54754, KF945434, FJ751738, KF945371, KF945256. Chusquea spencei Ernst. LC et al. 1269; KF945312, U62788, KF945435, KF945211, KF945372, KF945257. Chusquea subtessellata Hitchcock. SK 14; KF945313, U54753, KF945436, KF945212, KF945373, KF945258. Chusquea subtilis Widmer & L. G. Clark.AF 19; KF945314, JQ352322, KF945437, KF945213, KF945374, KF945259. Chusquea SYSTEMATIC BOTANY talamancensis Widmer & L. G. Clark. SK 16; KF945315, U62789, KF945438, KF945214, KF945375, KF945260. Chusquea tenella Nees. LC & XL 1032; KF945316, KF945618, KF945439, KF945215, KF945376,–. Chusquea tessellata Munro. LC et al. 1267; FJ751644, U54752, KF945440, FJ751737, KF945377, KF945261. Chusquea tomentosa Widmer & L. G. Clark. AF 20; KF945317, JQ352321, KF945441, KF945216, KF945378, KF945262. Chusquea tonduzii Hackel. SK 13; KF945318, JQ352319, KF945442, KF945217, KF945379, KF945263. Chusquea uliginosa R.A. Philippi. LC & ER 992; KF945319, KF945621, KF945443, KF945218, [Volume 39 KF945380, KF945264. Chusquea uniflora Steudel. LC & PA 1387; KF945320, KF945622, KF945444, KF945219, KF945381, KF945265. Chusquea urelytra Hackel. LC & XL 1052; FJ751648, FJ751665, KF945445, FJ751741, KF945382,–. Chusquea virgata Hackel.AF 34; KF945321, KF945623, KF945446, KF945220, KF945383, KF945266. Chusquea vulcanalis (Soderstrom & Calderón) L. G. Clark. SK 12; KF945322, U62790, KF945447, KF945221, KF945384, KF945267. Chusquea windischii L. G. Clark. LC & XL 1047; KF945323, U54755, KF945448, KF945222, KF945385,–.

RELATED PAPERS

RELATED TOPICS

Log In

Molecular Phylogeny Estimation of the Bamboo Genus <I>Chusquea</I> (Poaceae: Bambusoideae: Bambuseae) and Description of Two New Subgenera

Molecular Phylogeny Estimation of the Bamboo Genus <I>Chusquea</I> (Poaceae: Bambusoideae: Bambuseae) and Description of Two New Subgenera

Related Papers

RELATED PAPERS

RELATED TOPICS