American Journal of Botany: e262–e264. 2011. AJB Primer Notes & Protocols in the Plant Sciences CHARACTERIZATION OF 12 MICROSATELLITE LOCI FOR HYPOCHAERIS CHILLENSIS (ASTERACEAE) AND CROSS-AMPLIFICATION IN RELATED SPECIES1 Carina C. F. Lúcio2, Eduardo A. Ruas2, Luana A. Rodrigues2, Paulo M. Ruas2, Thiago Vidotto2, Laís Bérgamo de Souza2, Nelson I. Matzenbacher3, and Claudete F. Ruas2,4 2 Departamento de Biologia Geral, Centro de Ciências Biológicas, Universidade Estadual de Londrina, 86051-990 Londrina, Paraná, Brazil; and 3Departamento de Botânica, Universidade Federal do Rio Grande do Sul, 90010-460 Porto Alegre, Rio Grande do Sul, Brazil • Premise of the study: Hypochaeris is considered a biological model to understand evolutionary processes in the vascular flora of South America, particularly from the temperate portion of the continent. We report the development and characterization of microsatellite markers for H. chillensis to assess the genetic variability and patterns of population structure of the species. • Methods and Results: Twelve microsatellite primers were isolated using a CT- and GT-enriched genomic library. PCR amplification detected one to five alleles, with 2.91 alleles per locus on average. Tested for cross-amplification, all primer pairs were successfully amplified in 10 South American species and in the putative ancestor of the group, H. angustifolia. • Conclusions: The microsatellites can be used to assess genetic diversity and population structure of H. chillensis. Application in other species will focus on the elucidation of adaptive radiation of the genus in South America. Key words: codominant markers; genetic diversity; herbaceous species; SSR. The genus Hypochaeris L. has features that make it an interesting model for evolutionary and biogeographic studies in plants. The genus exhibits a disjunct distribution, with more than 15 representatives in the Mediterranean region and around 50 in South America (Tremetsberger et al., 2005, 2006). Studies have suggested that the genus originated in the Mediterranean region and radiated into the South American continent after a long-distance dispersion event of an ancestral species from northwestern Africa (Tremetsberger et al., 2005). Recent molecular and cytogenetic investigations identified in the Moroccan H. angustifolia (Litard. & Maire) Maire, recognized as the closest relative of the South American Hypochaeris, characteristics that are similar to those found in the South American group of species (Tremetsberger et al., 2005, 2006; Weiss-Schneeweiss et al., 2007). Hypochaeris chillensis (Kunth) Britton is a perennial herb native to South America that exhibits extensive ecological and morphological diversity throughout its distribution range. In contrast with the other South American species, H. chillensis is widespread, occurring from southeastern to southern Brazil as well as other South American countries, including Argentina, Uruguay, Paraguay, Peru, Bolivia, Ecuador, and Colombia 1 Manuscript received 12 April 2011; revision accepted 11 May 2011. This research was funded by Fundação Araucária (grant 5156/2009), the Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPQ; grant 555405/2009-5), and the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES; AUX-PE-PNPD2238/2009). 4 Author for correspondence: ruas@sercomtel.com.br doi:10.3732/ajb.1100177 (Azevêdo-Gonçalvez and Matzenbacher, 2007). The specific limits of H. chillensis are difficult to define, given the great extent of infraspecific differentiation recognized in this species. Cabrera (1976) noted that glabrous or hairy involucral bracts can occur in the same population and even in the same plant, and suggested that hybridization might be partly responsible for the great variability of characters (e.g., pubescence and leaf shape) recognized in H. chillensis. These observations are supported by recent studies reporting a high incidence of interspecific hybridization in populations where the co-occurrence of H. chillensis with other species is common (Azevêdo-Gonçalvez and Matzenbacher, 2007). Therefore, population studies on this species may help to understand the connection between longdistance dispersal and explosive radiation of the genus Hypochaeris into the South American continent. METHODS AND RESULTS Genomic DNA of H. chillensis and the related species were extracted from fresh leaves using the cetyltrimethyl-ammonium bromide (CTAB) method (Doyle and Doyle, 1987). An enriched microsatellite library was constructed with the DNA of a unique individual of H. chillensis using a hybridizationbased capture method, following the protocol described by Billotte et al. (1999), with biotin-labeled (CT)8 and (GT)8 in the enrichment step. Briefly, approximately 5 μg of genomic DNA was digested with RsaI (Promega, Madison, Wisconsin, USA) and blunt-ended fragments were linked to adapters (Rsa21 and Rsa25). Fragments containing repeats were selected by hybridization with the biotinylated oligonucleotides and recovered by streptavidin-coated magnetic beads (Invitrogen-Dynal, Lillestrøm, Norway). Microsatellite-rich fragments were amplified by PCR with the Rsa21 adapter as a primer, cloned into the pGEM-T Easy vector (Promega) and transformed into Escherichia coli XL1 Blue MRF′ supercompetent cells (Agilent Technologies, Stratagene Products American Journal of Botany: e262–e264, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America e262 September 2011] AJB Primer Notes & Protocols—Microsatellites in HYPOCHAERIS CHILLENSIS Division, La Jolla, California, USA). The enriched library was screened for the presence of inserts via PCR using 25 µL reaction mixtures containing, 5.0 µL of GoTaq Green Master Mix (Promega), 2.5 µL (10 pmol) of Rsa21 adapter as a primer, 2.5 µL of frozen recombinant colonies, and 15.0 µL of sterile water. Amplifications were carried out in a thermal cycler (PTC-200, MJ Research, St. Bruno, Quebec, Canada) programmed with a hot start of 4 min at 95°C, followed by 30 cycles of 94°C for 30 s, 52°C for 45 s, and 72°C for 1 min and 30 s, with a final extension at 72°C for 8 min. Plasmids were isolated from 280 positive clones and then sequencing reactions were performed in a volume of 10 µL containing 4 µL of the BigDye Terminator v.3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA), 1 µL (5pM) of either the forward or reverse M13 universal primer, 4 µL DNA template (ca. 400–600 ng of plasmid-containing inserts), and 1.0 µL of sterile water. Sequences were run on the ABI 3130XL Automated Sequencer (Applied Biosystems). Of the 280 sequenced inserts, 40 (14.29%) clones contained perfect, compound, and interrupted microsatellites; however, only 25 (8.93%) proved suitable for primer design. Primers were designed using the program PRIMER3 version 0.4.0 (Rozen and Skaletsky, 2000). PCR amplification and consistency of each primer pair were tested in a sample of five individuals from one population of H. chillensis. Reactions were performed in a volume of 10 µL containing 3.5 µL of GoTaq Green Master Mix (Promega), 0.25 µL (5 pmol) of each forward and reverse locus-specific primer (Table 1), and 2.0 µL (10 ng) of genomic DNA, adjusting the volume with sterile water. PCR profiles consisted of an initial denaturation step of 4 min at 94°C, followed by 16 touchdown cycles at 94°C for 30 s, 65−50°C (–1°C/cycle) for 30 s, 72°C for 1 min, followed by 30 additional cycles at 94°C for 30 s, 50°C for 30 s, and 72°C 1 min, with a final extension at 72°C for 7 min. The amplification products were resolved on a 7.0% polyacrylamide gel, sized by comparison with a 50 bp DNA ladder standard (Ludwig, Porto Alegre, Rio Grande do Sul, Brazil), and visualized after silver staining. Of the 25 primer pairs tested, 13 failed to amplify and 12 were selected for analysis. Eleven of the selected primer pairs yielded clear and consistent amplification patterns, of which 10 showed polymorphism and one (Hchi211) was monomorphic. Another primer (Hchi160) amplified bands that were difficult to score due to pronounced stuttering. Therefore, primers Hchi211 and Hchi160 were excluded from the characterization analysis, but they were maintained for the cross-amplification tests (Table 2). Table 1. For characterization of the 10 selected loci, we genotyped 50 individuals of H. chillensis, representing three native populations from southern and southeastern Brazil. Samples consisted of 32 individuals of a single population from Lages (LAG), Santa Catarina State (27°31′S, 50°53′W); five samples from Sapopema (SAP), Paraná State (23°53′S, 50°36′W); and 13 samples from Itapetininga (ITA), São Paulo State (23°36′S, 48°07′W). Vouchers were deposited at the Herbarium FUEL of the Universidade Estadual de Londrina (LAG: FUEL 48681, SAP: FUEL 48680, and ITA: FUEL 48810). The genotyping of H. chillensis and the cross-amplification tests were performed with the same reaction conditions and touchdown PCR profiles applied for primer optimization. For characterization of the polymorphic loci, we applied standard population genetic statistics, calculated using GENEPOP v.1.2 (Raymond and Rousset, 1995) as summarized in Table 1. To test for linkage disequilibrium we applied a sequential Bonferroni correction for multiple comparisons in determining a statistical significance level of 5%. The genotyping of 50 individuals of H. chillensis revealed moderate levels of polymorphism, with a total number of 32 alleles. The number of alleles ranged from one (Hchi211) to five (Hchi274), with an average of 2.91 alleles per locus (Table 1). Mean polymorphic information content (PIC) was 0.323 and observed (Ho) and expected (He) heterozygosity for each locus ranged from 0.023 to 1.000 and from 0.063 to 0.640, with mean values of 0.390 and 0.384, respectively (Table 1). Five loci showed allelic frequencies that significantly deviated from expected Hardy–Weinberg proportions (P ≤ 0.001), including two loci (Hchi36, Hchi159) with heterozygote deficit and three (Hchi105, Hchi108, Hchi233) with excess. Pairwise comparisons for multiple tests among the polymorphic loci showed significant linkage disequilibrium only between loci Hchi36/Hchi75, Hchi36/Hchi274, and Hchi75/Hchi274 (Bonferroni corrections, P ≤ 0.05). The 12 isolated microsatellite primers were tested for cross-amplification in 10 South American representatives of Hypochaeris and in H. angustifolia, the presumed ancestor of this group. Seven loci amplified in all South American species tested, producing alleles that were similar in length to those of H. chillensis. Three loci (Hchi75, Hchi105, Hchi159) failed to amplify in one species each, one (Hchi274) failed in two species, and another (Hchi15) failed in four species (Table 2). Cross-amplification was also successful for five loci in H. angustifolia (Table 2). The success of cross-amplification was expected given the close genetic relationship among the South American species of Hypochaeris, as a result of the recent divergence on the continent (Tremetsberger et al., 2006). Characteristics of 12 microsatellite loci isolated for Hypochaeris chillensis. Locus name/ GenBanka Hchi15 JF715914 Hchi36* JF715915 Hchi75 JF715916 Hchil105* JF715917 Hchi108* JF715918 Hchi159* JF715919 Hchi233* JF715921 Hchi254 JF715922 Hchi274 JF715923 Hchi279 JF715924 Hchi211b JF715920 Hchi160b JF784420 e263 Primer sequence (5′–3′) F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: F: R: GGGGGTTAATTTGTAAATAGGG TTGTCTCTCGAAGGGTCTCG GCTACCAGCTCCACCTTCTG GTTGCCTCCTTCTGGTTCAG GCATTGTGCTTCATAATGTGAG GGAAAAAGGAGCACATTCCA TGTCCGGAAACCTACTCTGG TTGAATACCACGGCACACTC CCTGACGATTGCACAAGAAA GCGCAGTGTTTCAGATTTTG TGCAAATATCCCAAAGTGTG TTCTCGATCGCAACCTCTC GTTTGCGGGTGTTGAAGTTT CTAGAAGCACCCACCAAACA CCCTTGTTCTCTCCCTGAAA ACCACACCACCGAGAGACA CCCCCAAGACCCTACACTA TGACAAATCTGTCTAAGAATTTTATGG GGAACAGAGTGGCTGCTTTT TTCGCATCCTTCTCTGACACT CCCACAATACGCATAACACAA TCTTCTAGCGATTTGCGACA CAACTCTCCCATCTTCTTCTCT AGGGTTCTTGTCTCCATCTAT Repeat motif A Allele size (bp) PIC Ho He (TG)4ATA(TG)2(GAAA)CAA (GAAA)3N12(GT)2A(TG)5 (TC)8 3 154–160 0.147 0.023 0.155 3 175–200 0.529 0.041 0.607 (CT)8(AT)7(CT)2 3 179–200 0.323 0.488 0.384 (CT)3T(TC)8ATGTT(TC)3C (CT)2N6(CT)3 (TC)4 3 188–210 0.445 0.958 0.554 2 249–270 0.375 1.000 0.505 (GT)6N85(AG)15 4 224–240 0.582 0.152 0.640 (GT)6 2 152–160 0.375 1.000 0.505 (GT)6N28(TC)4 3 158–180 0.061 0.064 0.063 (GTT)4GTC(GTT)13 5 120–152 0.310 0.133 0.342 GA(GAA)3(GAAAA)2GAAGA 3 140–160 0.079 0.042 0.082 (TG)4N82(CCA)2G(CCA)3 1 240 0.000 — — (TG)11 — 157 — — — A, number of alleles; He,, expected heterozygosity; Ho, observed heterozygosity; PIC, polymorphic information content. * Significant deviation from Hardy–Weinberg equilibrium (P ≤ 0.001). a GenBank accession number. b Primers Hchi211 and Hchi160 were included in Table 1 only for information on primer sequences and repeat motifs. They were excluded from the estimation of genetic parameters because Hchi211 was monomorphic and Hchi160 could not be scored due to pronounced stuttering. American Journal of Botany e264 [Vol. 0 Table 2. Twelve microsatellite loci developed for Hypochaeris chillensis and tested for cross-amplification in 22 samples, representing 10 species of the South American Hypochaeris and the Moroccan H. angustifolia. Species H. pampasica Cabrera H. petiolaris (Hook. & Arn.) Griseb. H. megapotamica Cabrera H. variegata (Lam.) Baker H. argentina Cabrera H. neopinnatifida Azevêdo-Gonç. & Matzenb. H. lutea (Vell.) Britton H. apargioides Hook. & Arn. H. albiflora (Kuntze) Azevêdo-Gonç. & Matzenb. H. catharinensis Cabrera H. angustifolia (Litard. & Maire) Maire Hchi15 Hchi36 Hchi75 Hchi105 Hchi108 Hchi159 Hchi160 Hchi211 Hchi233 Hchi254 Hchi274 Hchi279 Useful loci + + + + + + + + + + + + 12 + + + + + – + + + + + + 11 – + + + + + + + + + – + 10 + + + + + + + + + + + + 12 + + + + + + + + + + + + + + + + + + + + + + + + 12 12 – + + – + + + + + + + + 10 + + + + + + + + + + + + 10 – + – + + + + + + + + + 10 – + + + + + + + + + – + 10 + – – + + + – – – + – – 5 +, successful amplification with expected allele size; –, absence of amplification. CONCLUSIONS The 12 microsatellite primers herein described are the first set of molecular markers developed for H. chillensis, and they have potential for further investigation of genetic diversity and population genetic structure in this species. Some of the characterized loci are composed of interrupted microsatellites, which possibly increase the chance of homoplasy between comigrating alleles and therefore reduce the informativeness of these loci. Although size homoplasy in microsatellite loci may underestimate population genetic parameters, Estoup et al. (2002) demonstrated that homoplasy may not represent a significant problem for estimating Wright’s F statistics and other population assignment tests that are extensively used to investigate evolutionary processes that affect population genetic structure. Finally, the success of cross-species amplification suggests that the markers isolated for H. chillensis can be especially helpful for studies on population genetic structures of other Hypochaeris species and in understanding the processes of adaptive radiation and speciation of the genus since it arrived in the South American continent. LITERATURE CITED Azevêdo-Gonçalvez, C. F., and N. I. Matzenbacher. 2007. O gênero Hypochaeris L. (Asteraceae) no Rio Grande do Sul, Brasil. Iheringia Série Botânica 62: 55–87. Billotte, N., P. J. R. Lagoda, A. M. Risterucci, and F. C. Baurens. 1999. Microsatellite-enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 54: 277–288. Cabrera, A. L. 1976. Materiales para una revisión, del gênero Hypochoeris. I. Hypochoeris chillensis (H.B.K.) Hieron. Darwiniana 20: 312–322. Doyle, J. J., and J. L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. Estoup, A., P. Jarne, and J. M. Cornuet. 2002. Homoplasy and mutation model at microsatellite loci and their consequences for population genetics analysis. Molecular Ecology 11: 1591–1604. Raymond, M., and F. Rousset. 1995. Genepop (version 1.2): Population genetics software for exact tests and ecumenicism. The Journal of Heredity 86: 248–249. Rozen, S., and H. J. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers. In S. Krawetz and S. Misener [eds.], Bioinformatics methods and protocols: Methods in molecular biology, 365–386. Humana Press, Totowa, New York, USA. Tremetsberger, K., H. Weiss-Schneeweiss, T. F. Stuessy, R. Samuel, G. Kadlec, M. A. Ortiz, and S. Talavera. 2005. Nuclear ribosomal DNA and karyotypes indicate a NW African origin of South American Hypochaeris (Asteraceae, Cichorieae). Molecular Phylogenetics and Evolution 35: 102–116. Tremetsberger, K., T. F. Stuessy, G. Kadlec, E. Urtubey, C. M. Baeza, S. G. Beck, H. A. Valdebenito, et al. 2006. AFLP phylogeny of South American species of Hypochaeris (Asteraceae, Lactuceae). Systematic Botany 31: 610–626. Weiss-Schneeweiss, H., T. F. Stuessy, K. Tremetsberger, E. Urtubey, H. A. Valdebenito, S. G. Beck, and C. M. Baeza. 2007. Chromosome numbers and karyotypes of South American species and populations of Hypochaeris (Asteraceae). Botanical Journal of the Linnean Society 153: 49–60.