BÁO CÁO KHOA HỌC VỀ NGHIÊN CỨU VÀ GIẢNG DẠY SINH HỌC Ở VIỆT NAM - HỘI NGHỊ KHOA HỌC QUỐC GIA LẦN THỨ 5 DOI: 10.15625/vap.2022.0038 STUDY ON PHYLOGENETIC POSITION AND GENETIC RELATIONSHIP OF Altingia excelsa Noronha FROM LAO CAI, VIETNAM BY MOLECULAR DATA Le Chi Toan1,*, Nguyen Thi Phuong Thao1, Nguyen Thi Anh Duong1, Pham Thi Minh Anh1, Pham Thi Bich Ha1, Hoang Nguyen Tuan Phuong1, Tran My Linh1, Nguyen Thi Lien2, Nguyen Van Sang2, Do Thi Bich1, Nguyen Van Dinh1, Duong Tien Vien1, Nguyen Van Du3,4 Abstract. Exploring the genetic relationships between taxa provides important information in science. However, the phylogenetic studies to investigate the ralationship of Altingia from Vietnam are limitted. Altingia excelsa is a constructive species in the tropical rainforest, this species is of cultural importance in SE Asia and Vietnam. Identifying the phylogenetic position and genetic relationship of A. excelsa from Vietnam is significant in providing important information for studies in taxonomy, economic resource, and in medicine. The present study, based on the molecular data of seven DNA regions supported the relationship within the genus Altingia. Three clades were recognized in this genus. The species A. excelsa from Lao Cai province of Vietnam was well supported as closely related to A. siamensis by molecular data, this result is congruent with morphology, and distribution. Keywords: Altingiaceae, Altingia excelsa, phylogeny, molecular, morphology. 1. INTRODUCTION Altingiaceae (sweet gums), a family of aromatic and resinous trees, consists of about 15 living species, usually included in three genera: Altingia Noronha, Liquidambar L., and Semiliquidambar H. T. Chang (Ickert-Bond et al., 2005, 2007; Ickert-Bond & Wen, 2006, 2013). The genus Altingia Noronha includes few species, however, several species of this genus are significant economically and as medicine. Altingia excelsa Noronha a member of the genus Altingia was recognized to be distributed in southern China and SE Asia (Zhang et al., 2003). The species A. excelsa is a constructive species in the tropical rainforest, this species is of cultural importance, and has been used as local medicine and wood for a long time. Several phylogenetic studies including Altingia have been conducted (e.g. Shi et al., 2001; Ickert-Bond & Wen, 2006; Ickert-Bond & Wen, 2013; Scharfstein et al., 2020). Ickert-Bond et al. (2005, 2007) resolved the sister relationship between Altingia and Liquidambar within the Altingiaceae by using morphological data of both living and extinct species. However, results of molecular analyses from Shi et al. (2001) and 1 Hanoi Pedagogical University 2 Hung Vuong University 3 Institute of Ecology and Biological Resources (IEBR) - VAST 4 Graduate University of Science and Technology - VAST *Email: lechitoan@hpu2.edu.vn 2 PHẦN 1. NGHIÊN CỨU CƠ BẢN TRONG SINH HỌC 343 Ickert-Bond & Wen (2006) supported Altingia and Liquidambar as single clades. Ickert-Bond & Wen (2013) proposed nomenclatural revisions to place all the species of Altingia in the genus Liquidambar, the generic name with nomenclatural priority. In addition, the hybridization between species of Altingia and Liquidambar were mentioned (Chang, 1962; Bogle, 1986; Shi et al., 2001; Ickert-Bond & Wen, 2013), and species described as Semiliquidambar recently have been demonstrated to be of hybrid origin (Wu et al., 2010). This complicates the picture of phylogeny within the Altingiaceae family. More recently, Scharfstein et al. (2020) provided the systematic classification of Altingiaceae using both morphological and molecular data of living and extinct species. Thus, results from the previous studies indicated that the relationship of Altingia and its allies such as Liquidambar and Semiliquidambar is complex, and relationship of several Altingia species are unclear. Altingia excelsa was recorded to be distributed in SE Asia and in some areas of Vietnam such as Yen Bai and Lao Cai. Identifying the phylogenetic position and genetic relationship of A. excelsa from Vietnam is significant, as it can provide important information for studies in taxonomy, economic resource, and in medicine. Thus, the present study aims to (1) reconstruct the phylogeny of the genus Altingia; (2) clarify the phylogenetic relationship of A. excelsa from Vietnam. 2. MATERIALS AND METHODS 2.1. Taxon sampling, DNA extraction, amplification, sequencing We collected the two individuals of Altingia excelsa during a field trip, November 2021 in Ta Phin, Lao Cai, Vietnam. Additionally, we assembled molecular data from NCBI of Altingia and its allies to reconstruct the phylogenetic trees of Altingia based on the data including a total of 11 sample (Table 1). Seven molecular makers were used in this study including rbcL, matK, psaA-ycf3, rps16, TrnG, trnS-trnG and trnL-F (Table 1). Liquidambar orientalis was selected as outgroup. Table 1. Voucher information and GenBank accession numbers for DNA sequences generated or used in this study. “–” indicates missing data, and “XXX” represents sequences newly generated in this study. Species Altingia chinensis Altingia excelsa Altingia excelsa Altingia excelsa Altingia gracilipes Altingia obovata Altingia poilanei Locality Voucher of sample Ickert-Bond China 1261 E. A. Widjaja. s.n. Indonesia Chi Toan Le Le135 Vietnam Chi Toan Le Vietnam Le136 Ickert-Bond 1379 China Ickert-Bond China 1356_5 Ickert-Bond 1296 Vietnam trnL-trnF psaA-ycf3 rps16 trnS-trnG TrnG rbcL DQ352202 DQ352234 DQ352267 DQ352299 DQ352331 DQ352376 matK FJ719580 DQ352226 DQ352257 DQ352291 DQ352323 DQ352355 DQ352374 AF304520 XXX XXX – – – – – – – – XXX XXX XXX XXX DQ352207 DQ352239 DQ352272 DQ352304 DQ352336 DQ352379 AF133223 DQ352209 DQ352241 DQ352274 DQ352306 DQ352338 DQ352377 AF304523 DQ352210 DQ352259 DQ352275 DQ352307 DQ352339 – – BÁO CÁO KHOA HỌC VỀ NGHIÊN CỨU VÀ GIẢNG DẠY SINH HỌC Ở VIỆT NAM 344 Species Altingia siamensis Voucher Ickert-Bond 1281 Altingia sp. WP 227 Altingia Ickert-Bond yunnanensis 1295 Liquidambar orientalis Aksoy 5204 Locality of sample trnL-trnF psaA-ycf3 rps16 trnS-trnG TrnG rbcL matK Cambodia DQ352212 DQ352243 DQ352277 DQ352309 DQ352341 DQ352375 AF304521 – Vietnam DQ352214 DQ352245 DQ352279 DQ352311 DQ352343 AF274606 Vietnam DQ352211 DQ352242 DQ352276 DQ352308 DQ352340 DQ352378 GU576679 Turkey DQ352224 DQ352255 DQ352289 DQ352321 DQ352352 DQ352383 – Genomic DNA of Altingia excelsa was extracted from silica gel dried tissues using the CTAB procedure (Doyle & Doyle, 1987). Polymerase chain reactions and sequencing were performed using the primers designed by Ickert-Bond & Wen (2006), Vidal-Russell & Nickrent (2008) and Taberlet et al. (1991). The primers used for conducting PCR and sequencing were presented in Table 2. The PCR amplification reactions used MasterMix of the BioMed company. The PCR program consisted of 5 min at 95 °C, 37 cycles of 30 s at 95 °C, 50 s at 50 °C, and 1 min 30 s at 72 °C, with a final extension of 10 min at 72 °C. PCR products were purified on 1.0 % agarose gels. The PCR products were purified using BioMed multifunctional DNA fragment purification recovery kits and sequenced using the amplification primers. The bidirectional sequencing was completed using the ABI 3730 DNA Sequencer (Applied Biosystems, Carlsbad, California, USA). The sequences were aligned either in SeAl (Rambaut, 2007) or Geneious v.8.0.5 (Kearse et al., 2012). Locus matK rbcL trnL-F psaA-ycf3 rps16 TrnG trnS-trnG Table 2. Primers used for PCR and sequencing in this study Primer Sequence 5’–3’ Reference 78F CAGGAGTATATTTATGCACT Vidal-Russell & Nickrent, 2008 1420R TCGAAGTATATACTTTATTCG 1F ATGTCACCACAAACAGARAC Vidal-Russell & Nickrent, 2008 889R CTATCAATAACTGCATGCAT C CGAAATCGGTAGACGCTACG Taberlet et al., 1991 F ATTTGAACTGGTGACACGAG rpsF TGCGGATCGAACATCAATTGCAAC Ickert-Bond & Wen, 2006 rps2R ATGCAACGTCAAGCAGTTCC rpsF GTGGTAGAAAGCAACGTG CGACTT Ickert-Bond & Wen, 2006 rps2R TGCGGATCGAACATCAAT TGCAAC trnG2G AGATAGGGATTCGAACCCTCG Ickert-Bond & Wen, 2006 trnG2S GTAGCGGGAATCGAACCCGCATC Al_R510 CTATGTCAGCTTTTCTGTC Ickert-Bond & Wen, 2006 Al_F594 ACTGGCCCTCTTTTTTGA 2.2. Phylogenetic analyses Both the maximum likelihood (ML) and Bayesian inference (BI) were carried out for the phylogenetic analyses of Altingia. The ML analysis was performed using the program RAxML 8.2.10 (Stamatakis, 2006; Stamatakis et al., 2008) with the GTR + I + G substitution model for each molecular marker and the combined dataset at the Cyper PHẦN 1. NGHIÊN CỨU CƠ BẢN TRONG SINH HỌC 345 Infrastructure for Phylogenetic Research (CIPRES; www.phylo.org). ML bootstrap analysis was implemented with 1000 replicates. Bayesian inference was conducted in MrBayses 3.1.2 (Ronquist & Huelsenbeck, 2003). The best-fitting models for each marker and the combined data set were determined by the Akaike information Criterion (AIC) as implemented in jModelTest 2.1.6 (Darriba et al., 2012). Bayesian analysis of the combined data set used the GTR + I + G model as determined in jModelTest. The MCMC algorithm was run for 10,000,000 generations with four Markov chain Monte Carlo (MCMC) and trees were sampled every 1000 generations. The program Tracer 1.6 (Rambaut & Drummond, 2007) was used to check that effective sample size (ESS) for all relevant parameters were well above 200 indicating that stationarity probably had been reached. With the first 25 % of sampled generations (2500 trees) discarded as burn-in, a 50 % majority-rule consensus tree and posterior probabilities (PP) were obtained using the remaining trees. 3. RESULTS AND DISCUSSION The study generated 6 new sequences of Altingia excelsa. The lengths of individuals data sets of rbcL, matK, psaA-ycf3, rps16, TrnG, trnS-trnG and trnL-F are 1444, 1533, 783, 843, 653, 843, 977 bps, respectively. The combined dataset included 7076 aligned positions for the ingroups and outgroups (Figure 1). In the seven makers, psaA-ycf3, rps16, TrnG and trnS-trnG did not amplify efficiently despite optimization of PCR amplification conditions, while other DNA regions were easily amplified. Figure 1. The combined molecular dataset from seven DNA regions (rbcL, matK, psaA-ycf3, rps16, trnG, trnS-trnG and trnL-F) The results from ML and BI trees were highly congruent, the few differences had low support. Thus, we combined the results in ML tree with BS and PP values. The phylogenetic relationship within Altingia is presented in Figure 2. The combined molecular dataset indicated a strong support for most clades. Our molecular results well supported the relationship of Altingia, three major clades were recognized within the genus. The first clade includes A. yunnanensis and A. poilanei, the second clade includes A. gracilipes, A. obovata, A. chinensis and Altingia sp. The last clade including A. excelsa and A. siamensis. 346 BÁO CÁO KHOA HỌC VỀ NGHIÊN CỨU VÀ GIẢNG DẠY SINH HỌC Ở VIỆT NAM Figure 2. Maximum likelihood tree showing the phylogenetic relationship of Altingia. Nodal support is given above the branches as ML bootstrap values/Bayesian posterior probabilities The two species from Vietnam A. yunnanensis and A. poilanei formed a clade within the basal of Altingia by our molecular data (Figure 2), this result is not corroborate with proposal of Ferguson (1989) that A. poilanei and A. yunnanensis should be under A. chinensis. The two species also share some morphological charaters such as small tree, pubescent in young branches, inflorescences usually in racemes (Zhang et al., 2003), and they are distributed in northern Vietnam and southern China. Our results also supported that the Vietnamese Altingia species were closely related, but they did not form a clade (Figure 2). The molecular results supported that A. excelsa and A. siamensis are closely related, in which the two individuals A. excelsa from Vietnam are highly congruent in genetics with the individual from Indonesia (Figure 2). The two species share some morphological characters such as woody tree, flowers unisexual, male inflorescences globose, several, arranged in raceme, female inflorescence solitary in leaf axil. Moreover, the two species was recognized distributed in southern China and SE Asia. Thus, it's likely that the phylogenetic position of A. excelsa and A. siamensis resulted from the congruence in genetics, morphology, and distribution. The three species A. gracilipes, A. obovata, and A. chinensis share some morphological characters such as woody tree, flowers unisexual, infructescences PHẦN 1. NGHIÊN CỨU CƠ BẢN TRONG SINH HỌC 347 subglobose, stamen of male flowers very short, anthers obovoid, seeds brown. They are distributed in China and Vietnam (Zhang et al., 2003). Thus, the close relationship of the three species were well supported by our molecular data (Figure 2), morphology and distribution informations. Additionally, the molecular result also indicated that the two sister genera Altingia and Liquidambar have distinct in genetics. 4. CONCLUSIONS The study based on the molecular data of comprehensive taxon sampling supported the relationship within the genus Altingia. Three clades were recognized in this genus. The species A. excelsa from Lao Cai Province of Vietnam was well supported as closely related to A. siamensis by molecular data, this result is congruent in genetics, morphology, and distribution. REFERENCES Bogle A. L., Philbrick C. T., 1980, A generic atlas of hamamelidaceous pollens. Contrib Gray Herb Harv. Univ., 210: 29-103. Chang H. T., 1962. Semiliquidambar, novum Hamamelidacearum genus Sinicum. Sunyatsen Univ. Bull. Nat. Sci., 1:34–44. Darriba D., Taboada G. L., Doallo R., Posada D., 2012. jModel Test 2: more models, new heuristics and parallel computing. Nature Methods, 9: 772. Doyle J. J., Doyle J. L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull., 19: 11-15. Ferguson D. K., 1989. A survey of the Liquidambaroideae (Hamamelidaceae) with a view to elucidating its fossil record. In PR Crane, S Blackmore, eds. Evolution, systematics, and fossil history of the Hamamelidae. Clarendon, Oxford, 1: 249–272. Ickert-Bond S. M, Pigg K. B., Wen J., 2005. Comparative infructescence morphology in Liquidambar (Altingiaceae) and its evolutionary significance. Amer. J. Bot., 92: 1234-1255. Ickert-Bond S. M., Pigg K. B., Wen J., 2007. Comparative infructescence morphology in Altingia (Altingiaceae) and discordance between morphological and molecular phylogenies. Amer. J. Bot., 94: 1094-1115. Ickert-Bond S. M., Wen J., 2006. Phylogeny and biogeography of Altingiaceae: evidence from combined analysis of five non-coding chloroplast regions. Mol. Phylogenet. Evol., 39: 512-528. Ickert-Bond S. M, Wen J., 2013. A taxonomic synopsis of Altingiaceae with nine new combinations. PhytoKeys, 31: 21-61. Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., Thierer T., Ashton B., Mentjies P., Drummond A., 2012. Geneious basic: an integrated and extendable desktop software platform for the 348 BÁO CÁO KHOA HỌC VỀ NGHIÊN CỨU VÀ GIẢNG DẠY SINH HỌC Ở VIỆT NAM organization and analysis of sequence data. Bioinformatics, 28: 1647-1649. Posada D., 2008. jModelTest, phylogenetic model averaging. Mol. Biol. Evol., 257: 1253 -1256. Rambaut A., Drummond A. J., 2007. Tracer, Version 1.4. http://beast.bio.ed.ac.uk/Tracer. Ronquist F., Huelsenbeck J. P., 2003. MrBayes 3, Bayesian phylogenetic inference under mixed models. Bioinformatics, 19: 1572 -1574. Scharfstein A. R., Stockey R. A., Rothwell G. W., 2020. Evolution and phylogeny of Altingiaceae: Anatomically preserved infructescences from late Cretaceous deposits of vancouver island, British Columbia, Canada. Int. J. Plant Sci., 181: 000–000. Shi S., Huang Y., Zhong Y., Du Y., Zhang Q., Chang H., Boufford D. E., 2001. Phylogeny of the Altingiaceae based on cpDNA, matK, PYIGS and nr DNA ITS sequences. Plant Syst. Evol., 230:13–24. Stamatakis A., 2006. RAxML-VI-HPC, maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 2221: 2688-2690. Stamatakis A., Hoover P., Rougemont J., 2008. A Rapid Bootstrap Algorithm for the RAxML Web Servers. Syst. Biol., 575: 758-771. Taberlet P, Gielly L, Pautou G., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol., 17: 1105-1109. Vidal-Russell R., Nickrent D. L., 2008. Evolutionary relationship in the showy Mistletoe family (Loranthaceae). Amer. J. Bot., 95: 1015-1029. Wu W., Zhou R., Huang Y., Boufford D. E., Shi S., 2010. Molecular evidence for natural intergeneric hybridization between Liquidambar and Altingia. J. Plant Res., 123: 231-239. Zhang Z. Y., Zhang H. D., Endress P. K., 2003. Altingia. In: Wu ZY, Raven PH, Hong DY (eds.). Flora of China. Beijing: Science Press & St. Louis: Missouri Botanical Garden Press, 9: 19-21. PHẦN 1. NGHIÊN CỨU CƠ BẢN TRONG SINH HỌC 349 NGHIÊN CỨU VỊ TRÍ PHÁT SINH LOÀI VÀ MỐI QUAN HỆ DI TRUYỀN CỦA Altingia excelsa Noronha TỪ LÀO CAI, VIỆT NAM BẰNG DỮ LIỆU PHÂN TỬ Lê Chí Toàn1,*, Nguyễn Thị Phương Thảo1, Nguyễn Thị Ánh Dương1, Phạm Thị Minh Anh1, Phạm Thị Bích Hà1, Hoàng Nguyễn Tuấn Phương1, Trần Mỹ Linh1, Nguyễn Thị Liên2, Nguyễn Văn Sáng2, Đỗ Thị Bích1, Nguyễn Văn Đính1, Dương Tiến Viện1, Nguyễn Văn Dư3,4 Tóm tắt. Khám phá mối quan hệ di truyền giữa các đơn vị phân loại cung cấp thông tin quan trọng cho khoa học. Tuy nhiên, các nghiên cứu phát sinh loài nhằm điều tra, làm rõ mối liên hệ của chi Altingia ở Việt Nam còn hạn chế. Altingia excelsa là một loài tham gia vào cấu trúc rừng mưa nhiệt đới, loài này có vai trò quan trọng trong nhiều hoạt động đời sống của con người ở Đông Nam Á và Việt Nam. Việc xác định vị trí phát sinh loài và mối quan hệ di truyền của A. excelsa thu tại Việt Nam là công việc có ý nghĩa nhằm cung cấp thông tin quan trọng cho các nghiên cứu về phân loại học, tài nguyên kinh tế và y dược. Nghiên cứu này dựa trên dữ liệu phân tử của bảy vùng DNA đã trình bày và ủng hộ mối quan hệ di truyền trong chi Altingia. Ba nhánh phát sinh đã được ghi nhận bên trong chi này. Kết quả phân tích dữ liệu phân tử của chúng tôi ủng hộ mạnh mẽ rằng loài A. excelsa tại Lào Cai, Việt Nam có quan hệ di truyền gần với A. siamensis, kết quả này là tương đồng với các thông tin và dữ liệu hình thái và phân bố. Từ khóa: Altingiaceae, Altingia excelsa, phát sinh, phân tử, hình thái. ___________________________ Trường Đại học Sư phạm Hà Nội 2 Trường Đại học Hùng Vương 3 Viện Sinh thái và Tài nguyên Sinh vật - Viện Hàn lâm Khoa học và Công nghệ Việt Nam 4 Học viện Khoa học và Công nghệ - Viện Hàn lâm Khoa học và Công nghệ Việt Nam * Email: lechitoan@hpu2.edu.vn 1 2