Plant Syst. Evol. 239: 257–286 (2003)
DOI 10.1007/s00606-003-0013-2
An integrated molecular and morphological study of the subfamily
Suaedoideae Ulbr. (Chenopodiaceae)
P. Schütze, H. Freitag, and K. Weising
Systematics and Morphology of Plants, Department of Biology and Chemistry, University of Kassel,
Kassel, Germany
Received December 21, 2002; accepted March 5, 2003
Published online: May 15, 2003
Ó Springer-Verlag 2003
Abstract. As part of an ongoing project on the
phylogeny and taxonomy of Chenopodiaceae with
emphasis on the evolution of photosynthetic pathways, we sequenced the nuclear ribosomal ITS
region and two chloroplast DNA regions (atpBrbcL and psbB-psbH) of 43 taxa belonging to
subfamily Suaedoideae (Chenopodiaceae). Our
sampling covered 41 of c. 82 known species and
subspecies of Suaeda, beside several taxa not yet
described, the monotypic genera Bienertia and
Borszczowia as well as some representatives of
Salicornioideae that served as outgroups. In addition, we carried out morphological and leaf anatomical studies on an extended sampling set, also
including the monotypic genus Alexandra. Phylograms resulting from maximum parsimony analyses
of separate and combined data sets share several
common features. (1) Suaeda is monophyletic if
Borszczowia is included. (2) The position of Bienertia
is ambiguous, being sister to Suaeda in both
chloroplast trees, but showing affinities to Salicornioideae in the ITS tree. (3) Suaeda deeply divides
into two well-supported clades. One clade (Brezia
clade) solely consists of the annual C3 species of sect.
Brezia. The second clade (Suaeda clade) includes all
other sections. (4) The subclades of the Suaeda clade
are in general agreement with currently accepted
sections. A reassessment of morphological and
anatomical characters on the background of the
molecular trees resulted in the recognition of pistil
morphology and leaf type as key characters. All
major molecular clades are precisely defined by
characteristic combinations of pistil and leaf types.
The following taxonomic conclusions are drawn: the
status of Bienertieae Ulbr. is confirmed; Suaeda is
subdivided into the new subgenera Brezia (Moq.)
Freitag & Schütze and Suaeda; Borszczowia is
recombined into Suaeda and given sectional rank;
within Suaeda, sects. Brezia, Schanginia, Borszczowia, Suaeda, Physophora, Schoberia and Salsina
are recognized with some changes in circumscription; Alexandra is maintained at generic level
because of the lack of molecular data and its striking
morphological differences from Suaeda. A conspectus of Suaedoideae containing recognized species
and all supraspecific taxa is given. The molecular
results confirm that C4 photosynthesis has evolved
independently four times in the subfamily.
Key words: Bienertia, Borszczowia, Suaeda,
Alexandra, Suaedoideae, Chenopodiaceae, molecular phylogeny, leaf anatomy, C4 photosynthesis.
Introduction
The members of Chenopodiaceae exhibit an
enormous variation of C4-associated leaf types,
at least four of which occur in Suaeda Forssk.
ex Scop. and its close relatives (Carolin et al.
258
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
1975; Fisher et al. 1997; Freitag and Stichler
2000, 2002). We have initiated a joint project)1
on the phylogeny and taxonomy of Chenopodiaceae, with special emphasis on the evolution
of the C4 pathway. As a part of this project,
we present here a molecular phylogeny of
subfamily Suaedoideae Ulbr., a reassessment
of morphological and anatomical characters,
and a number of taxonomic adjustments.
In the last concise treatment of Chenopodiaceae, Kühn et al. (1993) included Suaedoideae in Salsoloideae and placed Suaeda,
Alexandra, Bienertia and Borszczowia in the
single tribe Suaedeae. This concept was challenged by a comprehensive rbcL analysis of 96
taxa of Chenopodiaceae and Amaranthaceae
with representatives of all subfamilies, tribes
and most genera (Kadereit, Borsch, Weising
and Freitag, in preparation – subsequently
referred to as Kadereit et al.). The rbcL data
suggested that Suaeda, Borszczowia and Bienertia are widely separated from Salsoloideae,
but closely related to Salicornioideae Ulbr.
Suaeda species formed a monophyletic group
that also included Borszczowia aralocaspica,
whereas the affinities of Bienertia cycloptera
remained somewhat ambiguous. These results
prompted us to revive subfamily Suaedoideae
Ulbr., consisting of the two tribes Suaedeae
and Bienertieae, albeit in circumscriptions that
differ slightly from those proposed by Ulbrich
(1934) (see below).
The species of both tribes are predominantly halophytes. They inhabit salt-marshes
in semideserts, deserts, and coastal habitats.
Many occur as dominant or co-dominant
species in their respective plant communities.
Predominant life forms are annuals and dwarf
shrubs, but true shrubs up to 3 m are also
known, as in the palaeotropical S. monoica
(Freitag 2001). Suaedeae have an almost global
distribution, but are especially abundant in
temperate zones. The most important centre of
1
In cooperation with Dr. Gudrun Kadereit, Institut für
Spezielle Botanik und Botanischer Garten der Universität
Mainz.
diversity is the area from the Mediterranean to
Central Asia.
Up to the account of Ulbrich in 1934, the
genera under discussion were included in tribe
Suaedeae and series/subfamily Cyclolobeae/
Salsoloideae (Meyer in Ledebour 1829; MoquinTandon 1840, 1849; Bentham and Hooker
1880; Volkens 1893). From his overall knowledge of Chenopodiaceae, Ulbrich was well
aware of the limited taxonomic significance
of the helically twisted embryo that was the
traditional reason for including Suaedeae in
Salsoloideae. He based his concept of Suaedoideae mainly on the absence of indumentum, different leaf anatomy, small-sized
bracteoles, and stigmas covered on all sides by
papillae. Bienertieae as a second tribe in
Suaedoideae was founded on the almost
complete fusion of fruit and perianth. However, all later authors ignored or, without
giving arguments, rejected Ulbrich’s proposals
(e.g. Kühn et al. 1993, Tzvelev 1996, Hedge
et al. 1997).
The monotypic C Asian genera Borszczowia
and Alexandra were established on the basis of
morphological characters and their status has
never been questioned. Three other monotypic
genera grouped with Suaedeae in Ulbrich’s
account are nowadays convincingly included
in Suaeda, i.e. Brezia heterophylla (Kar. & Kir.)
Moq., Calvelia pterantha (Kar. & Kir.) Moq.,
and Helicilla altissima Moq. Hypocylix kerneri
Wol. in Stapf has been transferred to Salsola.
Except the E Asian Helicilla thought to be
identical with Suaeda glauca Bunge (e.g. Iljin
in Ulbrich 1934, Zhu and Clemants 2002), all
taxa were studied by ourselves, and Suaeda
(=Brezia) heterophylla is represented in our
sampling.
The sectional subdivision of Suaeda is still
unsatisfactory. Suaeda is a taxonomically difficult genus, mainly because of the large
number of species and the scarcity of morphologically distinctive characters. Numerous proposals have been made for its infrageneric
grouping. Taxonomic history is reflected by an
increase from two to nine groups considered as
sections or even genera (Moquin-Tandon
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
1831, 1840, 1849; Volkens 1893; Ulbrich 1934;
Iljin 1936a,b; Townsend 1980; Tzvelev 1993),
with more important innovations made by
Moquin-Tandon (position of embryo in the
seed) and Iljin (pistil structure). In their recent
review that focused on sectional nomenclature
but otherwise is a compilation of existing data,
Schenk and Ferren (2001) recognized nine
sections: Brezia (Moq.) Volk. (= Heterosperma
Iljin), Schoberia (C.A. Mey.) Volk. (= Conosperma Iljin), Physophora Iljin, Suaeda, Salsina
Moq., Limbogermen Iljin, Macrosuaeda Tzvelev, Immersa Townsend, and Schanginia (C.A.
Mey.) Volk. In particular, sects. Limbogermen
and Immersa are poorly substantiated. Sect.
Limbogermen differs from Salsina only in
geographical distribution (New World versus
Old World), and the monotypic sect. Immersa
was separated from Salsina by the inferior
ovary in S. aegyptiaca, without taking into
consideration the semi-inferior condition in the
closely related S. arcuata. Otherwise, the
subdivision proposed by Schenk and Ferren
(2001) largely corresponds to that of Iljin
(1936a,b). An alternative classification scheme
with 11 units was presented by Akhani et al.
(1997), together with first hypotheses on
phylogenetic interrelationships. However, this
outline has remained hypothetical in many
aspects.
Interest in the subdivision of Suaeda was
stimulated by increasing knowledge of the
distribution of C3 and C4 photosynthesis within
Suaedeae. Relevant information was gained
from leaf anatomy and carbon isotope composition values (d13C). The pioneer work of
Carolin et al. (1975) on leaves of Chenopodiaceae included four C3 and eleven C4 species of
Suaeda, with all the former species grouped in
the ‘‘austrobassioid’’ and the latter in the
‘‘Kranz-suaedoid’’ leaf type, respectively.
Akhani et al. (1997) listed 36 Old World species
of Suaeda and Bienertia, 21 of which had C4
isotope signature. In his informal classification,
Akhani realized that subgeneric groups contained either C3 or C4 species. In a parallel
study on leaf anatomy and subgeneric relationships, mainly in N American taxa, Fisher et al.
259
(1997) reached the same conclusion. They listed
23 C4 and 17 C3 species respectively, with C4
characters occurring in sects. Immersa, Limbogermen, Macrosuaeda and Salsina, and C3
in the remainder. More recently, additional
isotope values were published and two more C4
leaf types were described as ‘‘conospermoid’’
and ‘‘borszczowioid’’ (Freitag and Stichler
2000). The ‘‘conospermoid’’ type is another
Kranz type confined to sect. Schoberia, whereas
the ‘‘borszczowioid’’ type and the ‘‘bienertioid’’ type (Freitag and Stichler 2002) are nonKranz C4 types and specific for the respective
monotypic genera.
To any field botanist, and even to the
trained taxonomist, Suaeda is a notoriously
difficult genus. Even in floristically well-known
areas, like Europe, Russia or N America, the
taxonomy of the genus is far from being
solved. Distinguishing characters are usually
few, inconspicuous and present only after
flowering. The problems encountered in defining Suaeda species are aggravated in the
numerous annuals in sects. Brezia and Schoberia. Most vegetative characters are highly
variable depending on salinity, water and
nutrient supply, competition etc. Many specimens in herbaria are inadequate for accurate
naming. In addition, in some groups speciation
processes are obviously highly active. Modern
revisions are needed and, from our experiences,
we predict that convincing results will depend
on supporting molecular data. The hitherto
unsettled situation is best reflected by the fact,
that before and during the present work we
detected three good new species of sect. Brezia
(for S. tschujensis see Lomonosova and Freitag
2003) and one of sect. Suaeda, beside several
‘‘microspecies’’.
As part of our Chenopodiaceae project, we
initiated a detailed molecular systematic analysis of the tribes Suaedeae and Bienertieae in
combination with a reassessment of morphological and anatomical characters. Here we
present results based on the comparative
sequencing of the nuclear ribosomal internal
transcribed spacer (ITS) region (Baldwin et al.
1995), as well as of two chloroplast intergenic
260
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
DNA regions (atpB-rbcL; Manen et al. 1994
and psbB-psbH; Xu et al. 2000) from 41
recognized species of Suaedeae and from
Bienertia, beside of 15 infraspecific or
unknown taxa. Our objectives were: (1) to test
the monophyly of Suaedeae and Bienertieae
with respect to Salicornioideae; (2) to test the
monophyly of the nine Suaeda sections as
circumscribed by Schenk and Ferren (2001)
and the informal groups delimited by Akhani
et al. (1997); (3) to identify major clades and
formulate hypotheses concerning phylogenetic
relationships within Suaedeae; (4) to reassess
the systematic relevance and evolution of
morphological/anatomical characters by comparison with the molecular phylogenies; and
(5) to propose adequate taxonomic adjustments. More details of the anatomical study
will be presented elsewhere (Freitag, Schütze
and Weising, unpubl. data).
Materials and methods
Plant material. Fifty-seven specimens were sampled including 41 of the c. 82 recognized species of
Suaeda and the monotypic genera Bienertia and
Borszczowia (Table 1). All sections of Suaeda listed
in Schenk and Ferren (2001) were represented in
the sampling. Most specimens were derived from
Eurasia, the main diversity centre of the genus.
Attempts to amplify PCR fragments from DNA of
older herbarium material of Alexandra lehmannii
were unsuccessful for all three DNA regions.
Unfortunately, we were unable to obtain living
plants or younger herbarium material of this
species. Eight species from six genera of the
presumably allied (see above) subfamily Salicornioideae as well as Bassia hyssopifolia (Camphorosmeae) were included as outgroups. Attempts to
include additional species of Salsoleae failed because of alignment problems, obviously due to the
considerable genetic distance. Leaf samples were
taken either from herbarium specimens, from the
field, or from plants grown from seeds in the
greenhouse. Whenever possible, fresh leaf material
was used directly for DNA isolation. Voucher
specimens of all newly collected samples have been
deposited in KAS. For further data on the sampled
specimens see Table 1. Identification was the
responsibility of the second author (HF) who has
been engaged in Chenopodiaceae taxonomy, including Suaedoideae, for many years (Freitag 1989,
2001; Freitag et al. 1997).
DNA isolation. Total DNAs were isolated from
50–100 mg of fresh, or 20–50 mg of silica-dried or
herbarium leaves of individual plants using either a
commercial kit (DNeasy Plant Mini Kit; QIAGEN;
NucleoSpin Plant; Macherey & Nagel), or following
a modified cetyl trimethylammonium (CTAB) procedure (Weising et al. 1995). DNA concentrations
were determined electrophoretically versus known
amounts of k DNA as standards. For PCR, DNA
samples were adjusted to a concentration of 2 ng/ll
in 10 mM Tris, 1 mM EDTA, pH 8.0.
DNA amplification. Primer pairs used for
PCR amplification of the nuclear ribosomal ITS
region, the chloroplast atpB-rbcL spacer and the
psbB-psbH spacers are listed in Table 2. All PCRs
were performed in 50 lL volumes using a Biometra T-Gradient Cycler. For some taxa, PCR
fragments were re-amplified using the same primers and PCR conditions to improve yield. For
ITS, each reaction contained 5-30 ng of genomic
template DNA, 1.5 mM MgCl2, 10 pmoles of each
of forward and reverse primer (Table 2), 0.2 mM
of each dNTP, 20 mM Tris-HCl pH 8, 50 mM
KCl, 10% dimethylsulfoxid (Sigma) and 0.5 units
Taq DNA polymerase (Invitrogen). After an
initial denaturation at 94°C for 3 min, a touchdown PCR was performed for 33 cycles, each
consisting of 94°C for 30 sec, 58–65°C (see below)
for 30 sec, and 72°C for 90 sec. Starting at 65°C,
the annealing temperature was reduced by 1°C per
cycle during the first eight cycles, and then left
constant at 58°C. Final extension was at 72°C for
10 min. For the two chloroplast regions, each
reaction contained 5–30 ng of genomic template
DNA, 1.5 mM MgCl2, 5–10 pmoles each of
forward and reverse primer, 0.1 mM of each
dNTP, 20 mM Tris-HCl pH 8, 50 mM KCl,
10 mM tetramethylammonium chloride (Sigma;
atpB-rbcL only) and 0.5 units Taq DNA polymerase (Invitrogen). After an initial denaturation
at 94°C for 3 min, PCR was performed for 30
cycles, each consisting of 94°C for 30 sec, 53°C
(psbB-psbH) or 55°C (atpB-rbcL) for 30 sec, and
72°C for 90 sec. Final extension was at 72°C for
10 min. To check for the presence of distinct,
single bands, aliquots of PCR products were
electrophoresed on 1.5% agarose gels and stained
with ethidium bromide.
Taxon
DNAID.
Locality
1144
1170
Suaeda crassifolia Pall.
Schmalz 55 (MJG)
Lomonosova 51a
(NS, KAS)
Lomonosova 79
(NS, KAS)
Lomonosova 71a
(NS, KAS)
Freitag 30.134 (KAS)
Suaeda ‘‘elegans’’
Freitag 28.269 (KAS)
1376
Suaeda heterophylla
(Kar. & Kir.) Bunge
Suaeda heterophylla
(Kar. & Kir.) Bunge
Suaeda heterophylla group
Lomonosova 51
(NS, KAS)
Lomonosova 51a
(NS, KAS)
Freitag 30.132 (KAS)
1037
Australia: NSW; Karuah
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
Russia: S Siberia; Karasuk distr.
(cult. 2001)
Kazakhstan: E Kaz. distr.
(cult. 2001)
NW Uzbekistan: Aidar-Kul
(cult. 2001)
Russia: Volgograd prov;
Lake Elton
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
NW Uzbekistan: Aidar-Kul
(cult. 2001)
Germany: Prov. Sachsen-Anhalt;
Hecklingen
Spain: Canary Islands;
Lanzarote
Austria: Prov. Burgenland;
Lake Neusiedler See
Bolivia: Depto. Oruro, Prov.
Eduardo Avaroa
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
Austria: Prov.
Burgenland; Lake
Neusiedler See
Russia: Volgograd prov.
Suaedeae/Suaeda/sect. Brezia
Suaeda australis Moq.
Suaeda corniculata group1
Suaeda corniculata group
Suaeda corniculata group
Suaeda maritima (L.) Dumort. Schütze 10.09.01
(KAS)
Suaeda maritima var.
Reys-Betancourt
perennans Maire
(TFC 41071, KAS)
Suaeda pannonica
Freitag 27.156 (KAS)
(Beck) Graebn.
Suaeda aff. patagonica
R. de Michel 2862
Speg.
(LPB, KAS)
Suaeda stellatiflora
Lomonosova 67a
G.L.Chu
(NS, KAS)
Suaeda stellatiflora
Lomonosova 67b
G.L.Chu
(NS, KAS)
Suaeda prostrata Pall.
Freitag 27.155
(KAS)
Suaeda prostrata Pall.
Freitag 28.305 (KAS)
1052
1062
1108
1063
1074
1084
1234
1375
1216
1067
1076
1161
1379
GenBank accession No.
atpB-rbcL
AY181766
AY181764
psbB-psbH ITS
AY181891 AY181826
AY181889 AY181824
AY181780
AY181905 AY181841
AY181779
AY181904 AY181840
AY181760
AY181885 AY181820
AY181765
AY181890 AY181825
AY181776
AY181901 Ay181837
AY181775
AY181900 AY181836
AY181774
AY181899 AY181835
AY181758
AY181883 AY181818
AY181768
AY181893 AY181829
AY181778
AY181903 AY181839
AY181782
AY181907 AY181843
AY181770
AY181895 AY181831
AY181771
AY181896 AY181832
AY181773
AY181898 AY181834
AY181772
AY181897 AY181833
261
Voucher
(Herbarium)
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Table 1. Origin and herbarium voucher information of the plant material used, and GenBank accession numbers of DNA sequences. The
nomenclature of Suaeda sections follows Schenk and Ferren (2001), that of tribes and subfamilies Ulbrich (1936)
262
Table 1 (continued)
Voucher
(Herbarium)
DNAID.
Locality
GenBank accession No.
Suaeda prostrata group
Freitag 28.793 (KAS)
1109
AY181769
AY181894 AY181830
Suaeda salsa (L.) Pall.
Freitag 28.053 (KAS)
1253
AY181762
AY181887 AY181822
Suaeda salsa group
Freitag 28.709 (KAS)
1024
AY181763
AY181888 AY181823
Suaeda salsa group
1171
AY181761
AY181886 AY181821
AY181767
AY181781
AY181892 AY181828
AY181906 AY181842
Suaeda tschujensis
Lomonosova & Freitag
Suaeda ‘‘venetiana’’
Lomonosova 126
(NS, KAS)
Schütze ER361 (KAS)
Lomonosova 80
(NS, KAS)
Lomonosova 82
(NS, KAS)
Freitag 28.330 (KAS)
C Turkey: Aksaray prov.;
Sultanhani (cult. 2001)
W Kazakhstan: Ural’sk prov.;
Lake Chelkar
N Turkey: Samsun prov.; Bafra
(cult. 2001)
Russia: S Siberia; Altai distr.
(cult. 2001)
S France: Rhone delta
Russia: S Siberia; Karasuk distr.
(cult. 2001)
Russia: S Siberia; Altai
mountains (cult. 2001)
Italy: Lagoons E Venezia
(cult. 2001)
AY181777
AY181902 AY181838
AY181759
AY181884 AY181819
sect. Immersa
Suaeda aegyptiaca Hasselq.
Freitag 30.120 (KAS)
1138
E Jordan: Azraq oasis
AY181788
AY181917 AY181853
1219
Bolivia: Depto. Potosi; Prov.
Nor Chichas
Bolivia: Depto. Oruro;
Prov. Eduardo Avaroa
USA: Arizona; Marcopa Co.
AY181797
AY181926 AY181863
AY181796
AY181925 AY181862
Suaeda moquinii
(Torr.) Greene
Torrico-Peca 101
(LPB, KAS)
R. de Michel
2982 (LPB, KAS)
Ickert-Bond 1122
(ASU, KAS)
AY181798
no data
sect. Macrosuaeda
Suaeda altissima Pall.
Freitag 28.150 (KAS)
1017
N Kazakhstan: Gur’yev prov.
(cult. 2001)
AY181785
AY181914 AY181850
sect. Physophora
Suaeda physophora Pall.
Freitag 28.041 (KAS)
1163
W Kazakhstan: Ural’sk prov.;
Lake Chelkar
AY181802
no data
sect. Salsina
Suaeda arcuata Bunge
Löffler 1/2001 (W)
1383
Iran: Fars prov; Lake Maharlu
AY181789
AY181918 AY181854
Suaeda spicata (Willd.) Moq.
Suaeda ‘‘sibirica’’
sect. Limbogermen
Suaeda divaricata Moq.
Suaeda foliosa Moq.
1181
1129
1169
1025
1217
1215
AY181864
no data
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Taxon
Suaeda articulata Aellen
Suaeda asphaltica Boiss.
Suaeda dendroides
(C.A. Mey.) Moq.
Suaeda fruticosa Forssk. ex
J.F. Gmelin
Suaeda fruticosa Forssk. ex
J.F. Gmelin
Suaeda microphylla Pall.
Suaeda monodiana Maire
Namibia: Etoscha pan
Israel: Dead Sea area
Uzbekistan: Syr-Darya prov.
AY181795
AY181786
AY181791
AY181924 AY181860
AY181915 AY181851
AY181920 AY181856
Freitag 31.138 (KAS)
1139
Jordan: Dead Sea area
AY181793
AY181922 AY181858
Freitag 21.500 (KAS)
1002
Pakistan: Punjab (cult 2000)
AY181792
AY181921 AY181857
Freitag 28.686 (KAS)
Bornkamm 28.09.86
(B, KAS)
Léonard 7466
(BR, KAS)
Hensen 03.04.01 (KAS)
1007
1229
Turkey: Kars prov.; Tuzluca
NW Egypt: Qattara depression
AY181790
no data
AY181919 AY181855
no data
AY181861
1238
Jordan: Aqaba
AY181794
AY181923 AY181859
1134
SE Spain: Almeria prov.;
Tabernas
AY181787
AY181916 AY181852
sect. Schanginia
Suaeda linifolia Pall.
Freitag 28.092 (KAS)
1210
AY181805
AY181932 AY181870
Suaeda paradoxa Bunge
Freitag 30.128 (KAS)
1004
W Kazakhstan: Ural’sk prov.;
Lake Chelkar
Uzbekistan: Syr-Darya prov.
AY181806
AY181933 AY181871
sect. Schoberia
Suaeda acuminata
(C.A. Meyer) Moq.
Suaeda carnosissima Post
Suaeda cucullata Aellen
Lomonosova 53a
(NS, KAS)
Freitag 31.159 (KAS)
Freitag 28.729 (KAS)
1175
no data
AY181912 AY181848
1137
1056
AY181783
no data
AY181910 AY181846
AY181909 AY181845
Suaeda eltonica Iljin
Freitag 28.242 (KAS)
1075
AY181784
AY181911 AY181847
Suaeda microsperma
(C.A. Mey.) Fenzl
Suaeda splendens (Pourr.)
Gren. & Godr.
Lomonosova 45a
(NS, KAS)
Freitag 27.205a (KAS)
1211
no data
AY181913 AY181849
no data
AY181908 AY181844
Schütze ER311 (KAS)
1164
NE Spain: Catalonia; Ebro delta AY181803
AY181930 AY181868
Freitag 10.2002 (KAS)
1373
E Turkey: Van prov.; Çaldiran
AY181931 AY181869
Suaeda monoica Forssk. ex
J.F. Gmelin
Suaeda vermiculata Forssk.
ex J.F. Gmelin
sect. Suaeda
Suaeda vera Forssk. ex
J.F. Gmelin
Suaeda ‘‘ekimii’’
1031
E Kazakhstan: Taldy-Kurgan
distr. (cult. 2001)
SE Syria: Palmyra oasis
C Turkey: Eskişehir prov.;
Polatle (cult. 2001)
Russia: Volgograd prov.;
Lake Elton (cult. 2001)
E Kazakhstan: Aktogay near
Lake Balkhash
SW Spain: Sevilla prov;
Isla Mayor
AY181804
263
Okaukungo 23.04.68 (W) 1212
Danin 2000 (HUJ)
1092
Freitag 30.127 (KAS)
1030
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Table 1 (continued)
Taxon
Suaeda ifniensis Caball.
Suaeda palaestina
Eig. & Zohary
Bienertieae
Bienertia cycloptera Bunge
Borszczowia aralocaspica
Bunge
Salicornioideae
Allenrolfea occidentalis
(S. Watson) Kuntze
Kalidium foliatum (Pall.)
Moq
Microcnemum coralloides
(Loscos & Pardo) Buen
Salicornia europaea L
Voucher
(Herbarium)
DNAID.
Locality
Jacobs 5873 (NSW)
1384
Reys-Betancort
(TFC 41074, KAS)
Podlech 48.924
Freitag 30.165 (KAS)
1160
N Australia: Queensland;
no data
Gladstone
Spain: Canary Islands; Lanzarote AY181800
AY181928 AY181866
1214
1140
Marocco
Jordan: Dead Sea area
AY181801
AY181799
AY181929 AY181867
AY181927 AY181865
Akhani 16.11.00 (KAS)
1027
AY181808
AY181935 AY181873
Ogar 10.2000 (KAS)
1028
Iran: Mobarakiyeh S Tehran
(cult. 2001)
E Kazakhstan: Uigur distr.
(cult. 2001)
AY181807
AY181934 AY181872
Piep. & Long 120
(UTG)
Freitag 28.141
1143
USA: Utah; Box Elder Co.
AY181910
AY181937 AY181875
1141
NW Kazakhstan : Gur’yev prov. ; AY181809
Novobogatinskoe
Turkey: Konya prov.; Çihanbeyli AY181811
AY181936 AY181874
Vural 7558
(GAZI, KAS)
Schütze 07.09.01 (KAS)
1081
Salicornia europaea L.
Salicornia fruticosa L.
Schütze ER313 (KAS)
Freitag 27.202 (KAS)
1166
1142
Sclerostegia moniliformis
Paul G. Wilson
Tecticornia australasica
(Moq.) Paul G. Wilson
Schmalz 184 (MJG)
Chenopodioideae
Bassia hyssopifolia
(Pall.) Kuntze
1
1218
M160
Germany: Prov. Sachsen-Anhalt;
Hecklingen
NE Spain: Catalonia; Ebro delta
SW Spain: Sevilla prov.;
Isla Mayor
SW Australia: Lake King
Jacobs 8685 (NSW)
M260
Freitag 30.106 (KAS)
1151
GenBank accession No.
no data
AY181827
AY181938 AY181876
AY181814
AY181941 AY181879
AY181815
AY181816
AY181942 AY181880
AY181943 AY181881
AY181813
AY181940 AY181878
N Australia: Queensland
AY181812
AY181939 AY181877
Uzbekistan: Syr-Darya prov.
(cult 2001)
AY181818
AY181944 AY181882
S. corniculata s. str. is not listed because the species lacks typification, and various interpretations on the type are possible
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Suaeda/sect. not defined
Suaeda arbusculoides
L.S. Sm.
Suaeda ifniensis Caball.
264
Table 1 (continued)
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
265
Table 2. Sequences of primers (5¢ to 3¢) used in the present study (f: forward; r: reverse). Unlabelled PCR
primer pairs were purchased from Roth (Karlsruhe, Germany). IRD-700 and IRD-800 labelled sequencing
primers were obtained from MWG Biotech
ITS-A
ITS-B
ITS-C
ITS-D
atpB-rbcL
psbB-psbH
f.: GGAAGGAGAAGTCGTAACAAGG
r.: CTTTTCCTCCGCTTATTGATATG
f.: GCAATTCACACCAAGTATCGC
r.: CTCTCGGCAACGGATATCTCG
f.: GAAGTAGTAGGATTGATTCTC
r.: CAACACTTGCTTTAGTCTCTG
f.: AGATGTTTTTGCTGGTATTGA
r.: TTCAACAGTTTGTGTAGCCA
DNA sequencing. Double-stranded PCR products (10–30 ng per reaction) were cycle-sequenced by
the dideoxynucleotide chain termination method
without further purification. Both strands were
sequenced bidirectionally in the same reaction, using
a ThermoSequenase Kit (Amersham Pharmacia
Biotech) and 2 pmoles of IRDye700- and IRDye800-labelled primers for the forward and reverse
reaction, respectively (Table 2). Sequencing reactions followed the protocol of the kit manufacturer.
After denaturation at 94°C for 3 min, cycle sequencing was performed for 20–25 cycles, each consisting
of 94°C for 30 sec, 53°C (psbB-psbH) or 55°C (atpBrbcL) or 58°C (ITS) for 30 sec, and 72°C for 90 sec. In
general, the same primers which were used for PCR
were also used for sequencing. In difficult cases,
additional ITS PCR and sequencing reactions were
performed with internal primers (ITS-C and D;
Table 2). Sequencing products were separated on
6% denaturing polyacrylamide gels (Sequagel XR,
National Diagnostics) in an automated Li-Cor
L-4200L sequencer.
Morphological and anatomical studies. All species used for the molecular analyses, as well as
additional taxa from which no sequences could be
obtained, were studied by classical taxonomic
methods. Besides herbarium material, in many
cases plants grown in the greenhouse or wetconserved samples collected during field work were
also used. Special emphasis was given to leaf
anatomy. After a first screening by hand sections,
representatives of most leaf types were studied in
detail by microtome sections (for details see Freitag
and Stichler 2000). The complete set of anatomical
results and their discussion with emphasis on
evolution of C4 photosynthesis in Suaedoideae will
be published elsewhere (Freitag, Schütze and
Blattner (1999)
Xu et al. (2000)
Xu et al. (2000)
Weising, unpubl. data.). Here we only include
results which are directly related to the subject.
Data analysis. Forward and reverse sequences
were compared and edited using the e-seq software
package (Li-Cor). Consensus sequences were
initially aligned by using the Align-IR software
(Li-Cor) with default settings. Automated alignments were adjusted manually where necessary.
Ambiguously aligned nucleotide positions were
excluded from the analysis. All sequences obtained
in the present study have been deposited in Genbank
(accession numbers listed in Table 1). Pairwise
nucleotide differences (= sequence divergence values) were calculated using the Kimura 2-parameter
option of MEGA version 2.1 (Kumar et al. 2001).
Phylogenetic analyses were performed on four
different data sets: (1) ITS only; (2) atpB-rbcL only;
(3) psbB-psbH only; (4) ITS and chloroplast regions
combined. The sampled data sets were not fully
congruent across all trees because not all species,
(e.g. S. physophora, S. arbusculoides) could be
amplified and/or yielded readable sequence from
all DNA regions investigated. Maximum parsimony
trees were reconstructed by PAUP* 4.0b10 (Swofford 2001) in 100 replicated heuristic searches, using
random stepwise addition of taxa, tree bisection
reconnection (TBR) branch swapping, and MULPARS in effect. For the psbB-psbH region, too many
minimal length trees were found so that PAUP ran
out of memory. In this case, 30.000 trees were saved
and used for the calculation of majority rule and
strict consensus trees. All characters and character
states were weighted equally. Insertion/deletion
mutations (indels) were treated as missing characters. For chloroplast and combined trees, presence
vs. absence of informative indels were added to the
data set as a 1/0 binary matrix. The extent of
266
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
homoplasy was estimated using the consistency (CI)
and retention indices (RI). Statistical support values
for nodes and clades were estimated by bootstrap
analyses with 500 replications (Felsenstein 1985).
Distance trees were constructed using the neighbour
joining method (Saitou and Nei 1987) implemented
in the PAUP program package. Distance matrices
were estimated based on the two parameter method
of Kimura (1980).
Results and discussion
The molecular data set
ITS sequence analysis. Distinct PCR products
and complete ITS-1 and ITS-2 sequences were
obtained for 65 specimens, including Bienertia,
Borszczowia and 54 of Suaeda. Start and end
positions of ITS-1, 5.8S-rDNA and ITS-2
regions were determined by comparison with
the respective Genbank entries of Spinacia
oleracea (accession AF062088). Whereas the
5.8S gene had a uniform length of 164 bp across
all taxa, ITS-1 and ITS-2 spacers varied in
length from 234-248 bp, and from 228 to 240 bp
respectively (Table 3). Sequence data from
various accessions of S. physophora were consistently illegible, suggesting the existence of
more than one ITS variant in this particular
species. The aligned matrix included 690 nucleotide positions. After removal of 23 ambiguously aligned characters from the ITS-2 region,
327 polymorphic positions remained of which
258 were parsimony-informative. Pairwise sequence divergence (excluding indels) ranged
from 0–24.6% within Suaedeae (excluding
Bienertia), and from 0–29.5% for the full data
set.
ITS tree. Defining Bassia hyssopifolia as
an outgroup, phylogenetic analysis of the ITS
data matrix generated 48 minimal length trees
of 1087 steps. One of these trees was arbitrarily
chosen to illustrate the numbers of steps
supporting each branch (Fig. 1). The majority
rule consensus of the individual trees presented
in Fig. 2 is highly resolved, with only few
polytomies and no branches collapsing in the
strict consensus. The tree is basically divided
into two sister groups, one comprising all
species of Salicornioideae and Bienertia cycloptera, the other group including all members of the Suaedeae. The limited bootstrap
support for both clades (62% and 72%,
respectively) is an obvious result of the
ambiguous position of Bienertia cycloptera.
Bootstrap values went up to 87 and 93%,
respectively, when Bienertia was removed from
the data set (not shown). Within the ingroup,
the C3 species of sect. Brezia form a strongly
supported clade (100% bootstrap) which
is sister to all other Suaeda sections and
Borszczowia aralocaspica in a nested position.
For clarity, we will refer to the former clade as
‘‘Brezia clade’’, and to the latter as ‘‘Suaeda
clade’’ in the following. The genetic divergence
between both clades is considerable.
Within the Brezia clade, a distinct and
highly supported dichotomy is apparent.
One subclade (corniculata subclade) is formed
by Suaeda tschujensis1169, S. pannonica1375,
S. corniculata group1052, S. corniculata
group1062, S. ‘‘sibirica’’ 1129 and S. aff.
patagonica1216. The second subclade is again
divided into two distinct subclades (prostrata
and maritima subclades in Fig. 2), both receiving bootstrap values >95%. The maritima
subclade appears more heterogeneous as is
evident from the long branches leading to
the basally placed species S. arbusculoides and
S. australis (see Fig. 1).
Subdivisions within the Suaeda clade roughly correspond to the sections as defined by Iljin
(1936a,b) and modified by Schenk and Ferren
(2001). It is composed of three subclades which
are unresolved at their basis (Fig. 2). The
Schanginia subclade (Fig. 2) contains Suaeda
linifolia and S. paradoxa (both sect. Schanginia),
together with Borszczowia aralocaspica. The
vera subclade contains the subshrub Suaeda
vera, hitherto the only known member of sect.
Suaeda, and the annual S. ‘‘ekimii’’, which has
only recently been discovered by one of us (HF)
in E Turkey. The remaining subclade is again
composed of three well-supported subclades
that are poorly resolved at their basis. The
palaestina subclade comprises the shrubby C3
species S. palaestina and S. ifniensis for which no
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
267
Table 3. DNA sequence characteristics of the analyzed regions. Where applicable, informations for genic
and intergenic regions are also given separately
Region
Size range
atpB-rbcL
psbB
psbB-psbT
psbT
psbT-psbN
psbN
psbN-psbH
psbB-psbH
523)804
41 (part.)
170)200
102
63)68
132
83)104
601)637
ITS1
5.8S
ITS2
ITS region
234)248
164
228)240
627)654
Alignment characteristics
Sequence divergence
Number of
positions
Polymorphic Parsimony
informative
Complete
data set
Suaeda Zincl.
Borszczowia
1011
41 (part.)
222
102
68
132
112
677
246
9
62
15
22
12
20
140
132
3
40
6
13
10
10
82
0)12,2%
0)8,4%
0)9,5%
0)6,7%
180
18
139
327
146
10
102
258
0)29,5%
0)24,6%
266
164
250
690
sectional affinities have yet been proposed. The
Schoberia subclade contains all species of that
section. Finally, the fruticosa subclade is collectively formed by numerous species attributed to
the remaining sections Salsina, Limbogermen,
Macrosuaeda and Immersa. Suaeda altissima
(sect. Macrosuaeda) groups at the base of this
subclade, whereas members of the New World
section Limbogermen and the Old World section
Salsina are intermingled with each other. S.
aegyptiaca (sect. Immersa) and S. arcuata (sect.
Salsina) appear as sister species. Most remarkable is the long branch leading to S. monoica.
Chloroplast DNA sequence analysis. Positions of genes were determined by comparison
with the Genbank entry of Spinacia oleracea
(accession NC_002202). For the atpB-rbcL
spacer region, distinct PCR products and
complete sequences were obtained for 60
specimens, including 50 of Suaedeae and
Bienertia. The presence of a minisatellite
interfered with the analysis of this region in
species of sect. Schoberia, where complete sequences could only be obtained for S. eltonica
and S. carnosissima. Sequence divergence
(excluding indels) was much lower as compared to the ITS data set (Table 3). It ranged
from identity to 8.4% among Suaedeae, and
reached a maximum of 12.2% between Bassia
hyssopifolia and Borszczowia aralocaspica. The
low level of nucleotide substitution was in
sharp contrast to the high incidence of indel
variation. Most indels were short duplications,
but some were exceptionally large. For example, S. vermiculata, a member of sect. Salsina
was distinguished by an autapomorphic indel of 313 bp in the atpB-rbcL spacer, and
S. aegyptiaca and S. arcuata shared a synapomorphic indel of 229 bp. The aligned atpBrbcL spacer matrix included 1011 nucleotide
positions of which 246 were polymorphic,
and 132 were parsimony-informative. Twelve
unambiguous and synapomorphic indels were
coded as binary characters and added to the
sequence matrix for tree construction.
For the psbB-psbH spacer region, distinct
PCR products and complete sequences were
obtained for 62 specimens, including 52 of
Suaedeae and Bienertia. Sequence divergence
values (excluding indels) ranged from identity
to 6.7% among Suaedeae, and reached a
maximum of 9.5% between Bassia hyssopifolia
and Suaeda crassifolia (Table 3). Indels were
as common as in the atpB-rbcL alignment. The
aligned psbB-psbH spacer matrix included
677 nucleotide positions. After removing 25
268
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
2
S. maritima 1084
S. "venetiana" 1025
1
1 S. salsa group 1171
15 4 S. corniculata group 1170
S. salsa 1253
maritima
subclade
1 S. salsa group 1024
9
S. crassifolia 1108
S. "elegans" 1376
17
25
S. australis 1144
28
S. arbusculoides 1384
1
10 S. spicata 1181
3
S. maritima var. perennans 1234
2
S.
prostrata group 1109
2
26
S. prostrata 1379
2 4 4 S. prostrata 1161
prostrata
1
S. stellatiflora 1067
subclade
S. stellatiflora 1076
1
2
S. heterophylla group 1074
2 S. heterophylla 1063
1 S. heterophylla 1037
18
S. tschujensis 1169
S. pannonica 1375
corniculata
1 S. corniculata group 1062
subclade
8 S. corniculata group 1052
S. "sibirica" 1129
4
S. aff. patagonica 1216
3
1 S. splendens 1031
S. eltonica 1075
4
1
Schoberia
S. cucullata 1056
4
12
subclade
S. carnosissima 1137
1
5 S. acuminata 1175
2
S. microsperma 1211
S. altissima 1017
8
5
4 S.4asphaltica 1092
S. fruticosa 1002
3
2
5
S. fruticosa 1139
8
S. articulata 1212
2
5
4 S. foliosa 1217
1
1
26
1 S. divaricata 1219
fruticosa
5
S. monodiana 1229
subclade
8
4
1
S. moquinii 1215
7
S. vermiculata 1134
3
3 3 S. aegyptiaca 1138
1
S. arcuata 1383
6
S. microphylla 1007
3 S. dendroides 1030
27
S. monoica 1238
8
S.
palaestina
1140
15
palaestina
26
S. ifniensis 1160
7
subclade
19
S. ifniensis 1214
21
S. vera 1164
vera
28
29
subclade
S. "ekimii" 1373
7
S. linifolia 1210
10
Schanginia
3
19
S. paradoxa 1004
subclade
11
Borszczowia aralocaspica 1028
Bienertia cycloptera 1027
22
Kalidium foliatum 1141
34
Allenrolfea occidentalis 1143
39
14
Microcnemum coralloides 1218
23
Tecticornia australasica M260
12
8
9
Sclerostegia moniliformis M160
13
28
3 Salicornia europaea 1081
23
Salicornia europaea 1166
33
Salicornia fruticosa 1142
2
3
43
59
62
49
10
30
94
23
Suaeda clade
10
Brezia clade
25
Bassia hyssopifolia 1151
Fig. 1. One out of 48 most parsimonious ITS trees of 1087 steps (CI ¼ 0.51; CI excluding autapomorphies ¼ 0.45; RI ¼ 0. 84)
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
87
87
63
83
97
82
96
100
99
97
74
99
72
100
69
67
99
65
100
68
84
100
99
62
88
79
99
82
51
91
85
92
51
100
99
100
72
65
55
69
96
72
100
100
prostrata
subclade
corniculata
subclade
Schoberia
subclade
fruticosa
subclade
Suaeda clade
100
100
maritima
subclade
Brezia clade
66
S. maritima 1084
S. "venetiana" 1025
S. salsa group 1171
S. corniculata group 1170
S. salsa 1253
S. salsa group 1024
S. crassifolia 1108
S. "elegans" 1376
S. australis 1144
S. arbusculoides 1384
S. spicata 1181
S. maritima var. perennans 1234
S. prostrata group 1109
S. prostrata 1379
S. prostrata 1161
S. stellatiflora 1067
S. stellatiflora 1076
S. heterophylla group 1074
S. heterophylla 1063
S. heterophylla 1037
S. tschujensis 1169
S. pannonica 1375
S. corniculata group 1062
S. corniculata group 1052
S. "sibirica" 1129
S. aff. patagonica 1216
S. splendens 1031
S. eltonica 1075
S. cucullata 1056
S. carnosissima 1137
S. acuminata 1175
S. microsperma 1211
S. altissima 1017
S. asphaltica 1092
S. fruticosa 1002
S. fruticosa 1139
S. articulata 1212
S. monodiana 1229
S. foliosa 1217
S. divaricata 1219
S. moquinii 1215
S. vermiculata 1134
S. aegyptiaca 1138
S. arcuata 1383
S. microphylla 1007
S. dendroides 1030
S. monoica 1238
S. palaestina 1140
S. ifniensis 1160
S. ifniensis 1214
S. vera 1164
S. "ekimii" 1373
S. linifolia 1210
S. paradoxa 1004
Borszczowia aralocaspica 1028
Bienertia cycloptera 1027
Kalidium foliatum 1141
Allenrolfea occidentalis 1143
Microcnemum coralloides 1218
Tecticornia australasica M260
Sclerostegia moniliformis M160
Salicornia europaea 1081
Salicornia europaea 1166
Salicornia fruticosa 1142
Bassia hyssopifolia 1151
269
palaestina
subclade
vera
subclade
Schanginia
subclade
Fig. 2. Majority rule consensus of 48 shortest ITS trees. The strict consensus tree shares an identical topology.
Numbers above branches represent bootstrap values in 500 replicates
270
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
ambiguously aligned characters, 148 polymorphic positions remained of which 72 were
parsimony-informative. Seven synapomorphic
indels were coded as binary characters and
added to the sequence matrix for tree construction.
Chloroplast DNA trees. For both chloroplast sequence alignments, heuristic searches
resulted in a large number of minimal length
trees. A total of 15.840 trees of 355 steps were
found for the atpB-rbcL spacer, and > 30.000
trees of 179 steps for the psbB-psbH spacer.
One atpB-rbcL tree was arbitrarily chosen to
illustrate the numbers of steps supporting each
branch (Fig. 3). Majority rule consensus trees
of the individual atpB-rbcL and psbB-psbH
trees are presented in Figs. 4 and 5, respectively. The topologies of both trees are quite
similar, but resolution is higher in the atpBrbcL tree. Topologies are also generally congruent between chloroplast trees and the ITS
tree, though the latter is much better resolved.
One main ambiguity relates to the position
of Bienertia cycloptera. In both chloroplast
trees, Bienertia is sister to Suaedeae (bootstrap
82 % and 87% for atpB-rbcL and psbB-psbH
trees, respectively). In contrast, Bienertia is
sister to the Salicornioideae clade in the ITS
tree (bootstrap 72%). Considering the branch
lengths leading to Bienertia, this ambiguous
behaviour could well be caused by long branch
attraction. In any case, Bienertia is clearly
outside Suaedeae and takes an intermediate
position between Suaedeae and Salicornioideae.
Within Suaedeae, chloroplast trees and ITS tree
reveal the same well-supported dichotomy of
two lineages, referred to here as Brezia clade and
Suaeda clade. Sequence divergence of both
cpDNA spacers is especially low within the
Brezia clade, with several species sharing identical sequences. As a consequence, most species
of this section are unresolved in the chloroplast
tree. However, two subclades are recognizable
in the atpB-rbcL tree (Figs. 3, 4). The first agrees
in species composition with the corniculata
subclade of the ITS tree except for the inclusion
of S. australis in a basal position. In the second
subclade the species of the maritima and
prostrata subclades from the ITS trees are
lumped together. These results are in strong
contrast to the well-resolved situation in the ITS
tree.
Subdivisions within the Suaeda clade correspond quite well between ITS and chloroplast trees. Five subclades are consistently
recognized by each of the three consensus
trees with moderate to high bootstrap support,
i.e. the Schanginia, palaestina, vera, fruticosa
and Schoberia subclades, respectively (compare Figs. 2, 4 and 5). S. physophora for which
no ITS sequence was obtained, grouped together with S. palaestina and S. ifniensis in the
palaestina subclade. The relative position of
these subclades to each other varies among the
different trees. For example, the palaestina
subclade separates the Schoberia and fruticosa
subclades in the chloroplast tree, while it is
sister to both in the ITS tree.
Combined analysis. A combined analysis
was carried out for those 58 specimens where
sequence information was obtained for all
three loci. The combined ITS/atpB-rbcL/
psbB-psbH data matrix consisted of 2378
characters, 713 of which were polymorphic,
and 472 were parsimony-informative. Phylogenetic analysis of this data matrix resulted in
72 most parsimonious trees of 1580 steps. The
topology of the strict consensus tree shown in
Fig. 6 is largely congruent with that of a
neighbour joining analysis based on Kimura
distances (not shown) and the ITS tree (Fig. 2)
but differs from the latter in two points: (1)
Bienertia cycloptera is sister to the Suaedeae as
in the chloroplast tree. (2) The vera and the
Schanginia subclades of the ITS tree are united
in a weakly supported (bootstrap 51%) clade.
Morphological/anatomical key characters
and molecular trees
All morphological and anatomical characters
which potentially appeared to be useful for
supraspecific classification up to subfamily
level were taken into account and checked
against the cladograms. As a result – not
surprisingly – pistil morphology and leaf
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
15
56
corniculata
subclade
Schoberia
subclade
palaestina
subclade
fruticosa
subclade
Suaeda clade
35
maritima/prostrata
subclade
Brezia clade
23
S. maritima 1084
S. "venetiana" 1025
S. crassifolia 1108
S. salsa group 1171
S. salsa 1253
S. salsa group 1024
S. "elegans" 1376
2 S. spicata 1181
23
S. maritima var. perennans 1234
S. prostrata group 1109
S. stellatiflora 1067
1 1
S. stellatiflora 1076
S. heterophylla group 1074
1
S. prostrata 1379
S. prostrata 1161
5
S. heterophylla 1063
S. heterophylla 1037
S. corniculata group 1170
1
S. pannonica 1375
1
S. corniculata group 1052
1
1 S. "sibirica" 1129
S. corniculata group 1062
28
S. aff. patagonica 1216
S. tschujensis 1169
9
S. australis 1144
3
S. carnosissima 1137
8
2
S. eltonica 1075
4
S. palaestina 1140
1
2
S. ifniensis 1214
3 3
S. ifniensis 1160
S.
physophora 1163
1
12
S. altissima 1017
S.
asphaltica
1092
5
2 S. vermiculata 1134
S. aegyptiaca 1138
2
1 4 S. arcuata 1383
2
3 S. microphylla 1007
S. dendroides 1030
2
S. fruticosa 1002
1
4
S. fruticosa 1139
5
1 S. articulata 1212
2
S. foliosa 1217
1
S. divaricata 1219
S.
moquinii 1215
21
6
S. monoica 1238
7
S. vera 1164
7
9
S. "ekimii" 1373
5
S. linifolia 1210
9
3
13
S. paradoxa 1004
13
Borszczowia aralocaspica 1028
Bienertia cycloptera 1027
4
Kalidium foliatum 1141
8
12
Allenrolfea occidentalis 1143
12
Microcnemum coralloides 1218
1 1
Tecticornia australasica M260
2
Sclerostegia moniliformis M160
2
2
Salicornia europaea 1081
9
1
10
Salicornia europaea 1166
5
Salicornia fruticosa 1142
271
vera
subclade
Schanginia
subclade
Bassia hyssopifolia 1151
Fig. 3. One out of 15.840 most parsimonious atpB-rbcL trees of 355 steps (CI ¼ 0.82; CI excluding
autapomorphies ¼ 0.73; RI ¼ 0.95). The data matrix includes 12 unambiguous synapomorphic indels which
were coded as binary characters
272
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
89
64
64
68
63
71
84
63
78
69
71
61
84
60
57
73
86
82
82
64
100
99
100
100
97
81
64
52
100
100
corniculata
subclade
Schoberia
subclade
palaestina
subclade
fruticosa
subclade
Suaeda clade
97
maritima/prostrata
subclade
Brezia clade
100
S. maritima 1084
S. "venetiana" 1025
S. crassifolia 1108
S. salsa group 1171
S. salsa 1253
S. salsa group 1024
S. "elegans" 1376
S. spicata 1181
S. maritima var. perennans 1234
S. prostrata group 1109
S. prostrata 1379
S. prostrata 1161
S. heterophylla 1063
S. heterophylla 1037
S. stellatiflora 1067
S. stellatiflora 1076
S. heterophylla group 1074
S. corniculata group 1170
S. pannonica 1375
S. corniculata group 1052
S. "sibirica" 1129
S. corniculata group 1062
S. aff. patagonica 1216
S. tschujensis 1169
S. australis 1144
S. carnosissima 1137
S. eltonica 1075
S. palaestina 1140
S. ifniensis 1214
S. ifniensis 1160
S. physophora 1163
S. asphaltica 1092
S. vermiculata 1134
S. aegyptiaca 1138
S. arcuata 1383
S. microphylla 1007
S. dendroides 1030
S. fruticosa 1002
S. fruticosa 1139
S. articulata 1212
S. foliosa 1217
S. divaricata 1219
S. moquinii 1215
S. altissima 1017
S. monoica 1238
S. vera 1164
S. "ekimii" 1373
S. linifolia 1210
S. paradoxa 1004
Borszczowia aralocaspica 1028
Bienertia cycloptera 1027
Kalidium foliatum 1141
Allenrolfea occidentalis 1143
Microcnemum coralloides 1218
Tecticornia australasica M260
Sclerostegia moniliformis M160
Salicornia europaea 1081
Salicornia europaea 1166
Salicornia fruticosa 1142
Bassia hyssopifolia 1151
vera
subclade
Schanginia
subclade
Fig. 4. Majority rule consensus of 15.840 shortest atpB-rbcL trees. Branches collapsing in the strict consensus
tree are indicated by dotted lines. Numbers above branches represent bootstrap values in 500 replicates
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
51
63
63
97
74
98
61
60
95
71
88
84
98
56
75
99
93
Schoberia
subclade
fruticosa
subclade
Suaeda clade
92
87
Brezia clade
100
S. maritima 1084
S. "venetiana" 1025
S. crassifolia 1108
S. australis 1144
S. tschujensis 1169
S. salsa group 1171
S. salsa 1253
S. salsa group 1024
S. corniculata group 1170
S. corniculata group 1062
S. corniculata group 1052
S. "sibirica" 1129
S. aff. patagonica 1216
S. pannonica 1375
S. "elegans" 1376
S. spicata 1181
S. maritima var. perennans 1234
S. prostrata group 1109
S. prostrata 1379
S. prostrata 1161
S. stellatiflora 1067
S. stellatiflora 1076
S. heterophylla group 1074
S. heterophylla 1063
S. heterophylla 1037
S. splendens 1031
S. cucullata 1056
S. eltonica 1075
S. carnosissima 1137
S. acuminata 1175
S. microsperma 1211
S. altissima 1017
S. microphylla 1007
S. dendroides 1030
S. fruticosa 1139
S. vermiculata 1134
S. divaricata 1219
S. asphaltica 1092
S. fruticosa 1002
S. foliosa 1217
S. aegyptiaca 1138
S. arcuata 1383
S. monoica 1238
S. articulata 1212
S. palaestina 1140
S. ifniensis 1160
S. ifniensis 1214
S. vera 1164
S. "ekimii" 1373
S. linifolia 1210
S. paradoxa 1004
Borszczowia aralocaspica 1028
Bienertia cycloptera 1027
Allenrolfea occidentalis 1143
Kalidium foliatum 1141
Tecticornia australasica M260
Sclerostegia moniliformis M160
Microcnemum coralloides 1218
Salicornia europaea 1081
Salicornia europaea 1166
Salicornia fruticosa 1142
Bassia hyssopifolia 1151
273
palaestina
subclade
vera
subclade
Schanginia
subclade
Fig. 5. Majority rule consensus of 30.000 shortest psbB-psbH trees of 179 steps (CI ¼ 0.81; CI excluding
autapomorphies ¼ 0.72; RI ¼ 0. 95). Branches collapsing in the strict consensus tree are indicated by dotted
lines. Numbers above branches represent bootstrap values in 500 replicates
274
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
structure were recognized as taxonomically
most significant (key) characters. They are
plotted on the combined consensus tree
(Fig. 6) and will be discussed in more detail.
Other characters will be commented on briefly.
Pistil morphology and evolution. The pistil
types differ in number and shape of stigmas
and their insertion on the top of the ovary. A
typical style is absent. The stigmas vary
considerably in length and are much longer
in female flowers. Density and length of
papillae is related to stigma dimensions. Important differences in pistil morphology were
already recognized by Iljin (see Fig. 1 in Iljin
1936a) and used for sectional subdivision. Iljin
distinguished 6 forms which are not fully
congruent with our 5 types which are described
below and drawn on Fig. 6:
(1) Brezia type: Stigmas 2(3), short and thick,
often ± flattened, with short papillae,
arising directly from the attenuated top of
the ovary that resembles a short style;
Brezia clade.
(2) Schanginia type: Stigmas (2)3, long and
thin, with long papillae, arising from a
shallow depression on the rounded top of
the ovary; Schanginia subclade.
(3) Vera type: Ovary like in Schanginia type;
stigmas hard to define in number, peltate
or star-like; vera subclade (in S. vera
with flattened lobes divided towards the
apex and the margins into numerous
narrow segments; in S. ‘‘ekimii’’ repeatedly
branched from the base), stigmatic papillae
short.
(4) Schoberia type: Stigmas (2)3(4), long and
thin, very rarely short, with elongated
papillae, arising from a deep depression
surrounded by a collar-like structure at the
top of the narrowed ovary; Schoberia,
palaestina and fruticosa subclades.
(5) Bienertia type: Similar to Brezia type, but
differing by the somewhat capitate stigmas.
From comparative morphology, it is obvious
that the simple pistil type occurring in the
Brezia clade is plesiomorphic because it is
ubiquitous in Chenopodiaceae including the
more basal subfamilies. The same is probably
true for the number and shape of stigmas. A
similar pistil type is also present in the related
Salicornioideae (see Fig. 203 in Ulbrich 1934),
and Bienertia (see our Fig. 6) shows only a
minor variant with slightly widened capitate
stigma lobes. On the other hand, the types
observed in the Suaeda clade with the stigmas
arising from a depression are unique in the
family. We therefore consider them as derived,
although it is difficult to imagine what their
adaptive value might be. Pistils with a shallow
depression (in Schanginia and vera subclades)
are certainly less progressed than those equiped with a distinct collar around a deep
depression (other subclades). The filiform
stigmas with elongated papillae are likely to
be apomorphic. As they might enhance catching of pollen grains in wind-pollinated Chenopodiaceae, it is not surprising that they have
evolved in many other groups outside of
Suaedoideae. Another evolutionary line resulting in enlarged stigmatic surfaces is represented by the peltate stigmas in the vera subclade.
Probably it started with branching of stigmas
near the base (S. ‘‘ekimii’’) and continued by
flattening in their lower parts (S. vera). This
interpretation of pistil evolution is well-supported by the topology of the Suaeda clade
within the molecular trees.
Leaf anatomy and evolution of leaf types. The
leaf types and their distribution are likewise
closely associated with individual clades
and subclades (Fig. 6). Whereas all taxa of
the Brezia clade are C3 plants and have a
c
Fig. 6. Strict consensus tree of 72 shortest trees of 1580 steps (CI ¼ 0.61; CI excluding autapomorphies ¼ 0.52;
RI ¼ 0. 87) resulting from the combined analysis of ITS + atpB-rbcL + psbB-psbH. Numbers above branches
represent bootstrap values in 500 replicates. Pistil types, leaf types and proposed new classifications are mapped
on the tree. Abbreviations: K C4 ¼ Kranz C4, nK C4 ¼ non-Kranz C4; Bi ¼ Bienertia, Bo ¼ Borszczowia,
Phy ¼ Physophora, Sua ¼ Suaeda, Sch ¼ Schanginia, Sco ¼ Schoberia
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
275
276
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
comparatively uniform leaf structure, the
majority of taxa in the Suaeda clade carry
out C4 photosynthesis and almost any subclade has its specific leaf type. The growing
number of leaf types and changes in plant
names have lead us in a few cases to change the
names that were used in earlier treatments. The
term ‘‘austrobassioid’’ applied by Carolin et al.
(1975) not only to leaves of Australian species
of Kochia sect. Austrobassia (nowadays genus
Sclerolaena), but also to the C3 species of
Suaeda is avoided because in the latter the
leaves differ considerably both from Sclerolaena
and among Suaedoideae. To match the diversity, three new leaf types are distinguished.
They will be documented by photos and
discussed in evolutionary respect elsewhere
(Freitag, Schütze and Weising, unpubl. data).
However, some results regarding the multiple
origin of C4 photosynthesis may be stated
here. The two non-Kranz C4 leaf types have
probably evolved independently in the Bienertia
and Schanginia clades, respectively. The two
Kranz C4 leaf types are placed in a third
lineage which has also originated directly from
C3 ancestors (Fig. 6). There they are associated
with the Schoberia and Salsina clades which
are sister to each other. Though comparative
morphology strongly suggests that both types
evolved in parallel (Freitag and Stichler 2002),
the molecular evidence is still equivocal.
C3 leaf types
(1) Brezia type (defined here): distinctly succulent, flattened to ± semiterete, on adaxial
side usually concave, at base slightly attenuated; vascular network in a curved ±
central plane; the 3–4 mesophyll layers on
each side strongly increasing in size towards the centre and with decreasing numbers of chloroplasts, the innermost 1(2)
layer(s) as aqueous tissue, usually devoid of
chloroplasts, without air spaces. – Brezia
clade.
(2) Vera type (defined here, see Fig. 8 in
Freitag and Stichler 2002): differs from
Brezia type by narrower, biconvex, needleshaped leaves narrowed at base into a
distinct petiole. – Vera and palaestina
subclades of Suaeda clade.
(3) Schanginia type (defined here): weakly
succulent, flat, vascular network in one
plane; cells of the 2 mesophyll layers on
each side ± equal in size and chloroplast
numbers, air spaces running through all
mesophyll layers. – Schanginia subclade
except Borszczowia.
Kranz C4 leaf types
(4) Salsina type (=C4 suaedoid type Carolin
et al. 1975, see Fig. 4 in Freitag and
Stichler 2000): strongly succulent, semiterete, more rarely flattened or ± terete;
vascular network in a curved or flat central
plane; hypodermis absent; palisade and
Kranz layers peripheral, Kranz cells equal
in size, with chloroplasts in centripetal
position; two inner layers as aqueous tissue,
devoid of air spaces and chloroplasts or with
few chloroplasts. – Fruticosa subclade. A
variant with a distinct gap in the two
chlorenchyma layers along the leaf edges
occurs in S. monoica. In fresh leaves this
is expressed by two translucent lines along
the leaf margins.
(5) Schoberia type (= ‘‘conospermoid’’ type,
see Fig. 5a,b in Freitag and Stichler 2000):
strongly succulent, semiterete; hypodermis
present, made up of very large waterstorage cells; palisade and Kranz layers
encircling the curved plane of vascular
network, Kranz cells very unequal in size,
with chloroplasts in centrifugal position. –
Schoberia subclade.
Non-Kranz C4 leaf types
(6) Borszczowia type (= ‘‘borszczowioid’’
type, see Fig. 2a–d in Freitag and Stichler
2000): succulent, ± semiterete; hypodermis present; one single layer of chlorenchyma, each cell with inner Kranz-like
and outer palisade-like compartment;
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
numerous peripheral bundles attached
with their phloem to the chlorenchyma,
central bundle surrounded by 1–2 layers
of aqueous tissue devoid of chloroplasts
and air spaces. – Borszczowia aralocaspica
in Schanginia subclade.
(7) Bienertia type (= ‘‘bienertioid’’ type, see
Figs. 3–7 in Freitag and Stichler 2002):
succulent, semiterete; vascular network in
a curved ± central plane; hypodermis
absent, 1–3 chlorenchyma layers, each with
central compartment functionally corresponding to a Kranz cell and outer to
palisade cells; two inner mesophyll layers
as aqueous tissue, devoid of chloroplasts
and air spaces. – Bienertia cycloptera.
Reassessment of other characters
Life form. All clades and subclades except the
palaestina subclade contain both annual and
shrubby species, with many transitions in
height and woodiness. Obviously the character
is not useful in classification above species
level. However, the question whether the
subfamily has derived from annual or woody
ancestors is of general taxonomic interest with
strong bearings on the interpretation of secondary stem and root structures. Plotting the
life form on the molecular trees (not shown)
indicates that the annual form could well be
basic in Suaedoideae. From the direct descendants of the basal groups, Bienertia is annual
as are the overwhelming majority in the Brezia
clade and all species of the Schanginia subclade. In the Brezia clade, only five perennial
taxa are known (S. maritima var. perennans,
S. esteroa, S. inflata, S. australis, S. arbusculoides) and with their weak woodiness they
resemble other secondary perennials. The
species of the Schoberia subclade are also
exclusively annuals, whereas the palaestina
subclade contains only shrubby species and
the large Salsina subclade has a few annual
species.
Seed position. Historically, the horizontal
versus vertical position of ovule and seed was
used as the prime character for subdivision in
Suaeda (Meyer in Ledebour 1829). Since then,
277
seed position has remained a useful character,
albeit a few groups exhibit varying states. Seed
position is always horizontal in Brezia and
Bienertia, and vertical in Schanginia, Borszczowia and Alexandra, but conditions are
ambiguous in Schoberia, Salsina, vera and
palaestina subclades. Taken together, the
molecular trees suggest that horizontal seed
position is plesiomorphic in Suaedoideae.
Seed morphology. Morphology of seeds in
Suaedoideae is very uniform. They are 0.6–3
mm in largest diameter, strongly to moderately
compressed lenticular, and the surface of the
crustaceous testa is either smooth and shining,
or variously reticulate, more rarely granular.
In some lines heterospermy has developed with
the second seed type being disc-shaped, larger
in diameter, and having a membranous, almost
transparent testa (for figures see e.g. Freitag
et al. 1997). The occurrence of heterospermy
was sometimes used for delimiting higher taxa,
e.g. by Iljin (1936b) in separating his subsections Spermacocca and Leiosperma in sect.
Schanginia. The taxonomic value attributed to
heterospermy by Iljin is also expressed in
coining the sectional name Heterospermae
(=Brezia). However, we found the character
less reliable as we observed it in all sections
except Salsina where eventually it may also be
found. Furthermore, some species never seem
to produce two different seed types, and in
others their proportion varies extremely
among individuals. Otherwise, size and surface
of seeds are important characters at species
level. In the subfamily, heterospermy appears
to be a symplesiomorphic character that was
lost in some lines or even in single species.
Fusion of tepals and ovary. This character
has been in use since Moquin-Tandon (1831,
1835) separated Suaeda from Schanginia by
their superior versus inferior ovaries. However,
its value is limited. In sect. Schanginia, species
with superior and semi-inferior ovaries occur
side by side, and in the related Borszczowia the
tepals are almost completely adnate to the
ovary. Another evolutionary line from a
superior to inferior ovary position can be
traced in S. arcuata and S. aegyptiaca of the
278
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Salsina clade. In Bienertia the fusion between
tepals and ovary also reaches high up. Overrating that character in Suaedoideae has
caused artificial taxonomic units, as can be
seen in Fig. 6 by comparing the positions
of Bienertia and Borszczowia (united in
tribe Bienertieae by Ulbrich 1934), and of
S. aegyptiaca (representing the monotypic sect.
Immersa according to Townsend 1980).
Perianth appendages. In some groups, winglike outgrowths are formed on the tepal back
after pollination, or the apical parts of tepals
enlarge in a horn-like manner. Horns were first
used for supraspecific classification by MoquinTandon (1835), and the occurrence and position
of wings were considered taxonomically highly
relevant by Ulbrich (1934). However, the distribution of these derived characters on the
different groups is scattered and inconsistent.
Horizontal wings are typical for Bienertia and a
few species of sect. Brezia, vertical wings occur in
Alexandra beside of vertical keels. The latter
might be present in Schoberia, and horn-like
enlarged tepals have been observed in the
corniculata group of the Brezia clade where they
sometimes occur together with wing-like outgrowths near the tepal base.
Taxonomic consequences
In this section, we propose a classification
which results from a critical synthesis of the
molecular trees and the morphological and
anatomical data. Because the topology of the
three individual trees (ITS, atpB-rbcL, and
psbB-psbH) – despite their overall congruence
– varies in a few respects, the discussion is
mainly based on the combined consensus tree
shown in Fig. 6. Pistil shape and leaf anatomy
types are attached to the clades and subclades
of the molecular tree. It is obvious that all
clades and most of the subclades correspond
with a specific combination of states of these
two key characters. To avoid unnecessary
repetition, we will generally refer to the
relevant paragraphs in the foregoing sections.
Because the intricate nomenclatural problems
of the sections in Suaeda were recently dealt
with lucidly by Schenk and Ferren (2001), no
complete synonymy is given. The account is
divided into three parts. In the first part, the
revised classification is outlined and discussed.
In the second part, some short comments on
the phylogeny and subdivision of subfamily
Salicornioideae are given. The third part
consists of a conspectus of Suaedoideae with
relevant taxonomic data and proposed nomenclatural changes.
Classification of Suaedoideae
Tribes in Suaedoideae. Bienertia cycloptera
shows conflicting relationships in the ITS and
cpDNA trees, with affinities to either Salicornioideae or Suaedeae. Despite this ambiguous
and somewhat intermediate position, we
include Bienertia in Suaedoideae and attribute tribal rank to it. The morphological
reasoning is given in detail in our rbcL paper
(Kadereit et al., in prep.), and in the Conspectus below. Deliberately, we discarded the
two alternative solutions, viz. rising it to an
independent subfamily, or including Suaedeae
and Bienertieae together with Halopeplideae
and Salicornieae into a much widened subfamily Salicornioideae. In maintaining tribe
Bienertieae Ulbr., we simultaneously change
the morphological circumscription given by
Ulbrich (1934) – for details see Conspectus –
and remove Borszczowia.
Genera in Suaedeae. After the separation
of Bienertia, the three traditional genera Suaeda, Borszczowia and Alexandra remain in
Suaedeae. Regarding Borszczowia aralocaspica,
our three molecular data sets indicate a nested
position within Suaeda as a member of the
Schanginia clade. This is congruent with important morphological characters, viz. Schanginia
type pistil, tepals almost fully adnate to the
ovary, and vertical seed position. Borszczowia
has the same habit as any typical species of
Suaeda. In describing Borszczowia, Bunge
(1878) did not stress any particular generic
character but obviously gave high value to the
almost complete fusion of tepals to the ovary.
The only strong apomorphy is the unique leaf
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
type which cannot be connected easily with the
other members of the clade. However, as the
Schanginia leaf type also differs considerably
from all other C3 leaf types, we should accept
particularly high plasticity in leaf structure in
that clade. Consequently, Borszczowia is recombined here with Suaeda. From the topology
of the trees and the taxonomic weight given to
the other clades in Suaeda, we were at first
strongly inclined to group Borszczowia in sect.
Schanginia. But differences from the species of
sect. Schanginia are so conspicuous, in particular regarding leaf structure, that we place
Borszczowia in a new section closely related to
sect. Schanginia. By that – and in neglecting the
somewhat uncertain position of Alexandra –
Suaeda becomes monophyletic.
Regrettably we were not able to include
Alexandra lehmannii Bunge in the molecular
analysis, but it was studied morphologically
and anatomically. The species agrees with the
Schanginia clade in pistil type, seed position
and leaf characters. Regarding its morphology,
we had to confirm all the statements of Bunge
(1843, 1847, 1852). Alexandra appears to be
more distinct from a typical Suaeda by the
wide bracts and their imbricate position hiding
the axillary flowers and causing an unusual
spike-like appearance of the upper part of the
plant. Furthermore, it differs by minute, linear
to thread-like bracteoles, by laterally compressed flowers with the 3–5 tepals devoid of
chlorophyll, and 2 of them equipped dorsally
with a delicate vertical wing exceeding the
top of the seed and giving the fruits a Thlaspilike shape. Alexandra seems to be related
to Suaeda sect. Schanginia but a final decision on its placement – either as a separate
section in Suaeda or as a distinct genus – has to
await convincing molecular data. Bunge (1847,
1852) classified it in his subtribe Schoberieae
together with several species which belong to
sect. Brezia.
Subgeneric classification within Suaeda.
Phylogenetic analyses of both cpDNA and ITS
sequences as well as the distribution of pistil
types provide strong evidence for the existence
of two fundamentally divergent clades, one
279
comprising the species belonging to section
Brezia, and the other including all other
hitherto accepted sections. We seek to acknowledge the high degree of genetic divergence and the strong evolutionary significance
of the associated pistil characters by recognizing the two subgenera Brezia and Suaeda.
Though being sister groups in all three molecular trees, subgenus Brezia appears to be more
primitive because of its pistil type and predominance of the annual life form.
Distribution of genetic variation within the
two new subgenera is quite uneven. As far as
the trees are congruent, based on sufficient
sampling, and matched by convincing morphological characters, the lineages formed by
strongly supported clades or subclades in
Fig. 6 are recognized as sections. In most cases
they are identical with the currently accepted
sections. However, in our account their number is reduced from 9 to 7: Brezia, Schanginia,
Borszczowia, Suaeda, Physophora, Schoberia,
Salsina, with the latter including Limbogermen,
Immersa and Macrosuaeda.
It should be mentioned that in Suaedoideae, except for the Schanginia subclade, the
conspicuous molecular divergence is only
poorly mirrored by morphological apomorphies that allow drawing distinct lines at
supraspecific levels. This is documented by
the contrast between 6 sections in subgenus
Suaeda versus 1 only in subgenus Brezia,
although the genetic distances between the
subclades in both subgenera are about the
same magnitude. If compared with similar
trees and morphological divergence that we)2
are just obtaining in our ongoing study in
Salsoloideae, we have to state that sectional
division in Suaedeae corresponds largely to
generic division in Salsoleae although both
subfamilies might be of similar age. The
differences in pistil structure and leaf anatomy
might justify a rise of most Suaeda sections to
generic status, but such a procedure would
disregard their overall similarities and lead to
2
Freitag and Kadereit
280
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
unwarranted renaming of most species.
Perhaps the lack of morphological divergence
in subgenus Brezia can be explained by
particularly strong selective pressures which
do not allow the species to deviate from
certain, well-adapted morphological traits. In
addition to strongly saline soils to which all
taxa of Suaedoideae are adapted, the habitats
of species belonging to subgenus Brezia are
subjected to long-lasting flooding. These
adverse conditions are perhaps best reflected
in the very small number of plant species able
to grow on these habitats and the open community structure (see, e.g. Freitag et al. 2001).
Sect. Brezia (Moq.) Volk. (=Heterosperma
Ulbr.). From the total of c. 31 recognized
species, 14 were included in the molecular
analyses, with an addition of about 10(!)
undescribed taxa, and a coverage of 3 from 7
species of the southern hemisphere. Contrary
to the high number of species and the
divergence in the ITS tree equalling that found
in subgenus Suaeda, for the time being we
recognize only one tribe in subgenus Brezia.
There are at least three arguments in favour of
that: (1) The three subclades well separated in
the ITS tree (maritima, prostrata, corniculata)
more or less collapse in the cpDNA trees,
and two taxa (S. australis, S. corniculata
group1170) move from the maritima to a
weakly supported corniculata subclade. Considering the high number of autapomorphies
inherent in these two species, their somewhat
ambiguous position may be a long branch
attraction effect. (2) Inclusion of N American
species into the sampling might bring more
changes to the topology of the Brezia clade. (3)
Although the ITS data strongly suggest that
the three subclades represent natural groups,
we are not aware of any convincing nonmolecular characters supporting formalized
subunits of subgenus Brezia.
Of particular interest in a plant geographical respect is the relationship and position of
the few species in the southern hemisphere.
S. aff. patagonica is the only species from
S. America. In all molecular trees, the taxon is
nested in the corniculata subclade and very
closely related to taxa from C and E Asia. It
may be even closer related to N American
species not included here. In any case, the low
genetic divergence indicates a rather recent
immigration event. In contrast, S. australis
from tropical SE Asia and S. arbusculoides
from likewise tropical N Australia have the
longest individual ITS branches in the subgenus, indicating more ancient colonization
events. Our results also emphasize that the
delimitation of some traditional species in
section Brezia is far from satisfactory, and
that many more taxa await appropriate studies
(e.g. S. corniculata, S. maritima, S. prostrata).
Sects. Schanginia (C.A. Mey.) Volk. and
Borszczowia (Bunge) Freitag & Schütze. Our
molecular studies covered 2 out of 3(4) recognized species, and the former Borszczowia
aralocaspica. The missing S. glauca was investigated morphologically. The delimitation of
section Schanginia including Borszczowia is
highly supported by all molecular trees. Both
chloroplast phylogenies suggest a sister relationship between the Schanginia subclade and
the remaining species of the Suaeda clade.
These relationships are not resolved in the ITS
and combined trees when all taxa are included.
However, the Schanginia subclade remains in
the same basal position in the ITS tree if sect.
Brezia is omitted from the analysis (not shown).
The molecular results suggested the inclusion of Borszczowia in sect. Schanginia. However, we decided to keep both separate mainly
because of their completely different leaf
structure. In a molecular respect, the two
species of sect. Schanginia studied are closely
related. Borszczowia is sister to both of them
and has probably departed early from the
common ancestors as indicated by its relatively
long branch in all trees, besides its unique leaf
type. It would be most interesting to know also
the molecular position of the E Asian taxa
S. glauca and S. asparagoides. In leaf type they
agree with other species of sect. Schanginia but
in their ‘‘petiolate’’ flower clusters and habit
they approach S. altissima in sect. Salsina.
Unfortunately both species were not available
for our analysis.
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Sect. Suaeda. The type species of the section and a new one (listed as Suaeda ‘‘ekimii’’)
were studied. The placement of the latter within
sect. Suaeda was initially suggested by the
essentially similar pistil type. It was confirmed
by the molecular analyses which unite both
species in the highly supported vera subclade
occupying a relatively basal position within the
Suaeda clade. The long branches indicate a
considerable distance between both species.
With regard to pistil type and life form, S. vera
appears to be more derived than S. ‘‘ekimii’’.
Sect. Physophora Iljin. Sect. Physophora
was also considered to be monotypic. Unfortunately, we were not able to generate a
readable ITS sequence from S. physophora,
despite the presence of distinct PCR products.
However, in the atbB-rbcL trees, the species
grouped together with S. palaestina and
S. ifniensis. Both were not yet assigned to
any section. The trees give conflicting informations on the phylogenetic relationships of
sect. Physophora with other sections. However,
its position close to sect. Suaeda is supported
by leaf anatomy. S. physophora approaches
sect. Suaeda by its shorter stigmas.
Sect. Schoberia (C.A. Mey.) Volk. Six out
of the c. 9 species known from this section were
analysed in the molecular study. They form a
well-supported clade in a derived position in
all trees, and they all have in common the same
very special Schoberia leaf type. The small
molecular divergence between the section
members is reflected by their morphological
similarity that is responsible for some unsolved
problems in species delimitation.
Sect. Salsina Moq. In our new circumscription of sect. Salsina, we include sects.
Limbogermen, Macrosuaeda and Immersa. The
coverage of the four former sections in the molecular study is as follows: Salsina (traditional) 9
out of 19, Limbogermen 3 out of 9, Macrosuaeda
and Immersa, 1 out of 1. A highly supported
monophyletic clade (fruticosa subclade in
Figs. 1–6) is consistently formed by all species
belonging to this section. This is confirmed by
the occurrence of the same derived pistil and
leaf types. From the neighbouring position to
281
Schoberia in the trees, and because of the same
pistil type in both sections, it can be concluded
that both sections are more closely related.
However, their different leaf types suggest that
they have evolved along different lines.
The topology of the fruticosa subclade varies
somewhat between the trees, but they agree in
showing S. altissima and S. monoica on long
individual branches in basal positions. The bulk
of the subclade is more homogeneous, though
different smaller groups can be recognized. It
was tempting to use the obviously isolated
positions of S. altissima and S. monoica for
subsectional classification, but supporting morphological arguments are scarce. S. altissima
would be the first candidate, and it was already
raised to the monotypic section Macrosuaeda by
Tzvelev (1993), although by error. He defined
Macrosuaeda only against sect. Schanginia
where it was placed by Iljin (1936b). He emphasized the ‘‘petiolate’’ partial inflorescences
which are most conspicuous in S. altissima.
But they occur, albeit scattered, in other species
of Salsina as well, e.g. in S. asphaltica, and even
in S. glauca of sect. Schanginia (see above).
Likewise, the annual life form which is otherwise
rare in Salsina reoccurs in a few other distantly
related species of the section (S. arcuata, S.
aegyptiaca, S. monodiana). In contrast to S.
altissima, the shrubby S. monoica has an apomorphic character in a peculiar variant of the
Salsina leaf type not known from any other
species: The leaves show 2 translucent lines
along the edges caused by gaps in the palisade
and Kranz cell layers. The molecular data
confirmed the results of earlier morphological
studies (Freitag, unpublished) which seriously
questioned the concepts of sects. Immersa (low
significance of inferior ovary) and Limbogermen
(geographical separation).
Remarks on tribal subdivision in Salicornioideae Ulbr.
In our analyses, 8 taxa from 6 genera of
subfamily Salicornioideae were included as
outgroups. They represent the two tribes
Halopeplideae Ulbr. (Kalidium, Allenrolfea)
and Salicornieae Dumort. (Microcnemum,
282
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Salicornia, Tecticornia, and Sclerostegia). The
topology of the trees regarding that clade is of
particular interest because in the parallel rbcL
study we found only weak support for the
morphologically based tribal subdivision
(Kadereit et al.). Traditionally, Salicornieae
are considered as being more derived. They are
defined by opposite, strongly transformed
leaves, whereas the leaves are alternate and
often less transformed in Halopeplideae. The
more basal positions of the two representatives
of Halopeplideae in the ITS, cpDNA and
combined trees give additional support to this
classical interpretation.
Conspectus of Suaedoideae Ulbr. 1934
The species lists attached to this conspectus are
based on a critical evaluation of the accounts in
recent Floras or checklists, and on scattered
relevant publications (reference list available
from the authors on request). They may not be
complete, but we hope they could serve as a
starting point for further studies. Uncertainties
on species numbers and delimitation exist in
particular in sects. Brezia, Schoberia and Salsina.
Tribe 1 – Bienertieae Ulbr. 1934: 560;
emend. Freitag & Schütze
Annual; all parts with caducous vesicular
hairs; leaves with Bienertia type C4 anatomy;
bracteoles small, herbaceous, with a green
dorsal line; tepals ± adnate to ovary, in fruit
with a continuous horizontal wing; pistil with 2
capitate stigmas; seeds horizontal.
1 gen., 1 sp. – NE Arabia, SW Asia,
southwestern C Asia.
Bienertia cycloptera Bunge ex Boiss.
Tribe 2 – Suaedeae Dumort. 1834
Annuals, perennial herbs, dwarf-shrubs or
shrubs; glabrous or with caducous uniseriate
hairs; C3 or C4 plants with anatomy differing
from Bienertia type; bracteoles small, membranous; tepals free or variously adnate to ovary,
in fruit usually enlarged, sometimes variously
winged or horned; pistil variously shaped,
stigmas 2–4; seeds horizontal or vertical. – Type:
as in sect. Suaeda.
2 gen.: Suaeda, Alexandra.
Genus Suaeda Forssk. ex Scop. 1777
Description as for tribe. – c. 82 spp. –
world-wide, predominantly N-hemisphere and
temperate.
Suaeda subgen. 1 – Brezia (Moq.) Freitag &
Schütze subgen. nov.
Stigmatibus 2 raro 3 brevibus, apice ovarii
gradatim attenuati enascentibus.
Key characters: Stigmas 2(3), short, usually ±
flattened, inserted directly on the top of the
gradually attenuated ovary, with short papillae; young stems striate, with alternating green
and pale or purplish longitudinal lines; leaves
with Brezia type C3 anatomy. – Type: S.
heterophylla (Kar.& Kir.) Bunge. – Basionym:
Brezia (as genus) Moq. 1849 in DC, Prodr.
13,2: 167.
Sect. 1: Brezia.
Suaeda sect. 1 – Brezia (Moq.) Volk. in Engl. &
Prantl, Nat. Pflanzenfam. 3,1: 80 (1893), emend.
Schenk & Ferren, Taxon 50: 868 (2001).
Annuals, rarely perennial herbs or subshrubs;
glabrous; leaves with Brezia type C3 anatomy;
tepals never adnate to ovary, sometimes with
horizontal wings or/and with horn-like enlarged upper parts of tepals; stigmas 2(3),
short, inserted directly on the top of the
gradually attenuated ovary (Brezia type pistil),
stigmatic papillae short; seeds horizontal. –
Type: S. heterophylla (Kar.& Kir.) Bunge.
c. 31 spp.; worldwide, mainly N-hemisphere
and temperate.
Eurasia and N Africa: S. albescens Lázaro
Ibiza, S. arctica Jurtzev & Petrovsky, S. corniculata (C.A. Mey.) Bunge, S. crassifolia Pall.,
S. heterophylla (Kar. & Kir.) Bunge, S. heteroptera Kitag., S. japonica Makino, S. kossinskyi
Iljin, S. liaotungensis Kitag., ?S. malacosperma
Hara, S. maritima (L.) Dumort., S. olufsenii
Pauls., S. pannonica (Beck) Graebner, S. prostrata Pall., S. przewalskii Bunge, S. salsa (L.)
Pall., S. spicata (Willd.) Moq., S. stellatiflora
G.L. Chu, S. tschujensis Lomonosova & Freitag
(ined.).
N America: S. calceoliformis (Hook.) Moq.,
S. esteroa Ferren & Whitmore, S. linearis
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
(S. Elliott) Moq., S. mexicana (Standl.)
Standl., S. occidentalis (S. Watson) S. Watson,
S. puertopenascoa M.T. Watson & Ferren,
S. rolandii Basset & Crompton
S America: S. densiflora A. Soriano (prob.
here), S. patagonica Speg.
S Africa: S. inflata Aellen
S Asia and Australia/New Zealand: S. australis
Moq., S. arbusculoides L.S. Sm., ?S. novaezelandiae Allan.
Suaeda subgen. 2 – Suaeda
Stigmatibus 3 raro 2 vel 4 filiformibus raro
brevibus, apice ovarii in depressione enascentibus.
Key characters: Stigmas (2)3(4), inserted in
an apical depression of the ovary; young stems
not striate, uniformly light green; leaves with
C4 anatomy, or with C3 anatomy differing
from Brezia type. – Type as in sect. Suaeda.
Sects. 2–7: Schanginia, Borszczowia, Suaeda,
Physophora, Schoberia, Salsina.
Suaeda sect. 2 – Schanginia (C.A. Mey.) Volk.
in Engl. & Prantl, Nat. Pflanzenfam. 3,1: 80
(1893), emend. Schenk & Ferren, Taxon 50:
869 (2001).
Annuals; glabrous; leaves with Schanginia
type C3 anatomy; tepals free or fused with
ovary only in lower parts; without distinct
vertical wings; stigmas (2)3, filiform, inserted
in a shallow depression on the rounded top of
ovary (Schanginia type pistil), stigmatic papillae long; seeds vertical, prominently granular.
– Type: S. linifolia Pall. ex J.F. Gmel.
3(4) spp.; C and E Asia: S. glauca (Bunge)
Bunge (?incl. S. asparagoides (Miq.) Makino),
S. linifolia Pall., S. paradoxa Bunge.
Suaeda sect. 3 – Borszczowia (Bunge)
Freitag & Schütze sect. nov.
Tepalis fere omnino ovario adnatis, foliorum anatomia propria praedita.
Key characters: leaves with Borszczowia type
C4 anatomy; bracts similar to leaves; tepals
almost completely fused and adnate to ovary,
unwinged and unkeeled. – Type: Borszczowia
aralocaspica Bunge.
1 sp.; C. Asia: Suaeda aralocaspica (Bunge)
Freitag & Schütze comb. nov.. Basionym:
283
Borszczowia aralocaspica Bunge 1878, Trudy
Imp. S.-Peterburgsk. Bot. Sada 5: 643.
Suaeda sect. 4 – Suaeda
Annuals or dwarf shrubs; glabrous or with
caducous uniseriate hairs; leaves with Vera type
C3 anatomy; tepals free from ovary, sometimes
with horn-like outgrowths in the fused lower
parts; stigmas forming a complex peltate or starlike structure, inserted in a shallow depression at
top of ovary (Vera type pistil), stigmatic papillae
short; seeds usually horizontal. – Type: Suaeda
vera Forssk. ex J. F. Gmel.
2 ssp.; Med., SW Asia: Suaeda vera Forssk.
ex J. F. Gmel., S. ‘‘ekimii’’ (ined.).
Suaeda sect. 5 – Physophora Iljin, Sov. Bot. 5:
44 (1936), emend. Freitag & Schütze
Dwarf shrubs; glabrous or papillose; leaves
with Vera-type C3 anatomy; tepals free from
ovary; stigmas (2)3, rather short to moderately
long, inserted in a shallow depression at top of
ovary, stigmatic papillae long; seeds horizontal. – Type: S. physophora Pall.
3(4?) ssp.; Med., C Asia: S. ifniensis Caball.,
S. palaestina Eig & Zoh., S. physophora Pall.
Suaeda sect. 6 – Schoberia (C.A. Mey.) Volk.
in Engl. & Prantl, Nat. Pflanzenfam. 3,1: 80
(1893), emend. Schenk & Ferren, Taxon 50:
870 (2001).
Annuals; glabrous; leaves with Schoberia
type C4 anatomy; tepals free from ovary, often
vertically keeled, without appendages; stigmas
(2)3, filiform, inserted in a deep depression and
engirdled at base by a collar-like rim (Schoberia type pistil); seeds horizontal or vertical.
–Type: Schoberia acuminata C.A. Mey. in
Ledebour.
c. 9 spp.; Med., SW, C and E Asia.
S. acuminata (C.A. Mey.) Moq. (incl. S. baccifera Pall., S. confusa Iljin and S. pterantha
(Kar. & Kir.) Bunge), S. carnosissima Post,
S. cucullata Aellen, S. eltonica Iljin, ?S. kareliniana Fenzl, ?S. laevissima Kitag. (not seen,
probably sect. Brezia), S. microsperma (C.A.
Mey.) Fenzl, S. splendens (Pourr.) Gren. &
Godr., S. turkestanica Litv. (incl. S. rigida
Kung & G.L. Chu).
284
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Suaeda sect. 7 – Salsina Moq., Chenop.
monogr. enum. 121 (1840).
Dwarf shrubs or shrubs, rarely annuals;
usually densely hairy by caducous uniseriate
hairs; leaves with Salsina type C4 anatomy;
tepals free or partially fused with ovary,
without appendages; stigmas (2)3(4), inserted
in a deep depression and engirdled at base by a
collar-like rim (Schoberia type of pistil), papillae elongated; seeds horizontal or vertical.
– Type: S. vermiculata Forssk. ex J.F. Gmel.
c. 30 spp.; Eurasia, Africa, N and S
America.
Eurasia, N & E Africa: S. aegyptiaca Hasselq.,
S. altissima (L.) Pall. ex J.F. Gmel., S. arcuata
Bunge, S. arguinensis Maire, S. asphaltica
(Moq.) Moq., S. baluchestanica Akhani &
Podl., S. dendroides (C.A. Mey.) Moq.,
S. fruticosa Forssk. ex J.F. Gmel., S. micromeris Brenan, S. microphylla Pall., S. mollis
Desf., S. monodiana Maire, S. monoica Forssk.
ex J.F. Gmel., S. moschata A.J. Scott,
?S. paulyana Vierh., S. vermiculata Forssk. ex
J.F. Gmel.(=S. pruinosa Willk. & Lange).
S Africa: S. articulata Aellen, ?S. caespitosa
Wolley-Dod, S. merxmuelleri Aellen, S. plumosa Aellen, S. salina B. Nord.
N America: S. californica S. Watson,
S. conferta (Small) I.M. Johnston, S. moquinii
(Torr.) Greene, S. palmeri (Standl.) Standl.,
S. tampicensis (Standl.) Standl., S. taxifolia
(Standl.) Standl.
S America: S. argentinensis A. Soriano,
S. divaricata Moq., S. foliosa Moq.
Genus Alexandra Bunge, Linnaea 17: 120 (1843)
Related to Suaeda sect. Schanginia but
differing by the following characters: leaves
and particularly bracts much wider, the latter
imbricate, giving the inflorescences a spike-like
appearance and hiding the axillary partial
inflorescences; bracteoles minute, linear; flowers strongly compressed; perianth devoid of
chlorophyll, 2 of the 3-5 tepals with prominent
vertical wings exceeding the top of seed, and
the smaller fruits, developing from female
flowers, resembling those of Thlaspi.
1 sp.; C Asia: A. lehmannii Bunge 1843.
We thank many colleagues for supply of plant
material, in particular Maria Lomonosova (Novosibirsk), Surrey Jacobs (Sidney), Ladislav Mucina
(Phuthaditjhaba/S Africa), Stefan Beck (La Paz),
Stefanie Ickert-Bond (Tempe), and the curators of
some herbaria, in particular of M and B. Gudrun
Kadereit kindly made available to us DNA from
several species of Salicornioideae. We got reliable
assistance by Irene Diebel who prepared the slides
and by Cornelia Baeßler and Doris Franke who did
the drawings included in Fig. 6. For critical comments on the taxonomic part we are indebted to
Maria Lomonosova and Gerhard Wagenitz (Göttingen), and for a final linguistic check we thank Ian
Hedge (Edinburgh). Finally, the support by a grant
from the Deutsche Forschungsgemeinschaft (DFG
We1830/2-1) is gratefully acknowledged.
References
Akhani H., Trimborn P., Ziegler H. (1997) Photosynthetic pathways in Chenopodiaceae from
Africa, Asia and Europe with their ecological,
phytogeographical and taxonomical importance.
Plant Syst. Evol. 206: 187–221.
Baldwin B. G., Sanderson M. J., Porter J. M.,
Woiciechowski M. F., Campbell C. S., Donoghue M. J. (1995) The ITS region of nuclear
ribosomal DNA: a valuable source of evidence
on angiosperm phylogeny. Ann. Missouri Bot.
Gard. 82: 247–277.
Bentham G., Hooker J. D. (1880) Genera Plantarum III, part 1. Pamplin, Reeve & Co., London.
Blattner F. R. (1999) Direct amplification of the
entire ITS region from poorly preserved plant
material using recombinant PCR. BioTechniques 27: 1180–1186.
Bunge A. (1843) Novum genus Chenopodearum.
Linnaea 17: 120.
Bunge A. (1847) Alexandri Lehmanni reliquiae
botanicae. Mém. Acad. Imp. Sci. St. Pétersburg,
Divers Savans 5: 181–271.
Bunge A. (1852) Beitrag zur Kenntnis der Flora
Rußlands und der Steppen Central-Asiens.
Mém. Acad. Imp. Sci. St. Pétersburg, Divers
Savans 7: 177–535.
Bunge A. (1878) Salsolacearum novarum in Turkestania indigenarum descriptiones. Trudy Imp.
S. Peterburgsk. Bot. Sada 5: 642–646.
Carolin R. C., Jacobs S. W. L., Vesk M. (1975)
Leaf structure in Chenopodiaceae. Bot. Jahrb.
Syst. 95: 226–255.
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Felsenstein J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39: 783–791.
Fisher D. D., Schenk H. J, Thorsch J. A., Ferren
W.R. (1997) Leaf anatomy and subgeneric
affiliation of C3 and C4 species of Suaeda
(Chenopodiaceae) in North America. Amer.
J. Bot. 84: 1198–1210.
Freitag H. (1989) Contributions to the chenopod
flora of Egypt. Flora 183: 149–173.
Freitag H. (2001) Suaeda. In: Ali S. I., Qaiser M.
(eds.) Flora of Pakistan 204. Dept. Botany,
Karachi & MBG Press, St. Louis, pp. 104–126.
Freitag H., Stichler W. (2000) A remarkable new
leaf type with unusual photosynthetic tissue in a
C Asiatic genus of Chenopodiaceae. Plant Biol.
2: 154–160.
Freitag H., Stichler W. (2002) Bienertia cycloptera
Bunge ex Boiss., Chenopodiaceae, another C4
plant without Kranz tissues. Plant Biol. 4: 121–
132.
Freitag H., Walter J., Wucherer W. (1997) Die
Gattung Suaeda (Chenopodiaceae) in Österreich, mit einem Ausblick auf die pannonischen
Nachbarländer. Ann. Naturhist. Mus. Wien
98B, Suppl.: 343–367.
Freitag H., Golub V. B., Yuritsina N. A. (2001)
Halophytic plant communities in the northern
Caspian lowlands: 1, annual halophytic communities. Phytocoenologia 31: 63–108.
Hedge I. C., Akhani H., Freitag H., Kothe-Heinrich
G., Podlech D., Rilke S., Uotila P. (1997) Chenopodiaceae. In: Rechinger K.-H.(ed.) Flora Iranica
172. Akad. Verlagsgesellschaft, Graz, 371 p.
Iljin M. M. (1936a) K sistematike roda Suaeda
Forssk. i triby Suaedeae Rchb.. Sov. Bot.
1936(5): 39–49 (in Russian). On the systematics
of genus Suaeda Forssk. and tribe Suaedeae
Rchb.
Iljin M. M. (1936b) Chenopodiaceae Less. In:
Komarov V. L., Shishkin B. K. (eds.) Flora
SSSR 6. Akademia Nauk, Moskva/Leningrad,
pp. 2–354 (engl. transl. 1985. Singh/Koeltz,
Dehra Dun).
Kimura M. (1980) A simple method for measuring
evolutionary rates of base substitutions through
comparative studies of nucleotide sequences.
J. Mol. Evol. 16: 111–120.
Kühn U., Bittrich V., Carolin R., Freitag H.,
Hedge I. C., Uotila P., Wilson P. G. (1993):
Chenopodiaceae. In: Kubitzki K. (ed.) The
285
families and genera of vascular plants 2. Springer, Berlin New York London, pp. 253–281.
Kumar S., Tamura K., Jakobsen I. B., Nei M.
(2001) MEGA2: Molecular evolutionary genetics analysis software.
Ledebour C. F. (1829) Flora Altaica 1. Reimer,
Berlin.
Lomonosova M., Freitag H. (2003) A new species
of Suaeda (Chenopodiaceae) from the Altai.
Willdenowia 33, (in press).
Manen J.-F., Savolainen V., Simon P. (1994) The
atpB and rbcL promoters in plastid RNAs of a
wide dicot range. J. Mol. Evol. 38: 577–582.
Moquin-Tandon A. (1831) Essai monographique
sur le genre Suaeda et sur les Chenopodiacées les
plus voisiennes. Ann. Sci. Nat. (Paris) 23: 278–
325.
Moquin-Tandon A. (1835) Conspectus generum
chenopodearum. Ann. Sci. Nat., Ser. 2, Bot. 4:
209–218.
Moquin-Tandon A. (1840) Chenopodearum monographica revisio. Loss, Paris, 182 p.
Moquin-Tandon A. (1849) Salsolaceae. In: Candolle A. P. de (ed.) Prodromus Systematis Naturalis Regni Vegetabilis 13,2: 43–219. Treuttel &
Würtz, Paris/London.
Saitou N., Nei M. (1987). The neighbor joining
method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–425.
Schenk H. J., Ferren W. R. (2001) On the sectional
nomenclature of Suaeda (Chenopodiaceae). Taxon 50: 857–873.
Swofford D. L. (2001) PAUP*: Phylogenetic analysis using parsimony, version 4.0b10. Sinauer
Associates, Sunderland, Mass.
Townsend C. C. (1980) Contributions to the flora
of Iraq: XIII. Notes on some genera of Chenopodiaceae. Kew Bull. 35: 291–296.
Tzvelev N. N. (1993) Notes on Chenopodiaceae of
Eastern Europe. Ukrainsk. Botan. Zurn. 50: 78–
85. (Russian with Engl. summary).
Tzvelev N. N. (1996) Suaedeae Reichenb. In:
Tzvelev N. N. (ed.) Flora Europae Orientalis 9.
St. Petersburg, pp. 92–98.
Ulbrich E. (1934) Chenopodiaceae. In: Engler A.,
Prantl K. (eds.) Die natürlichen Pflanzenfamilien, ed. 2, 16c. Duncker & Humblot, Leipzig,
pp. 379–584.
Volkens G. (1893) Chenopodiaceae. In: Engler A.,
Prantl K. (eds.) Die natürlichen Pflanzenfamilien, ed. 1, 3. Engelmann, Leipzig, pp. 36–91.
286
P. Schütze et al.: An integrated molecular and morphological study of the subfamily Suaedoideae
Weising K., Nybom H., Wolff K., Meyer W. (1995)
DNA fingerprinting in plants and fungi. CRC
Press, Boca Raton, Fl., 322 p.
Xu D. H., Abe J., Sakai M., Kanazawa A.,
Shimamoto Y. (2000). Sequence variation of
non-coding regions of chloroplast DNA of
soybean and related wild species and its implications for the evolution of different chloroplast haplotypes. Theor. Appl. Genet. 101:
724–732.
Zhu G. L., Clemants S. E. (2002) Chenopodiaceae.
In: Flora of China 5 (draft). Science Press,
Beijing & MBG Press, St. Louis.
Address of the authors: Dipl.-Biol. Peter Schütze,
Prof. Dr. Helmut Freitag, Prof. Dr. Kurt Weising
(e-mail: weising@uni-kassel.de), Systematics and
Morphology of Plants, Department of Biology and
Chemistry, University of Kassel, D-34109 Kassel,
Germany.
helmut freitag